Incidental Mutation 'R5343:Ninl'
ID422426
Institutional Source Beutler Lab
Gene Symbol Ninl
Ensembl Gene ENSMUSG00000068115
Gene Nameninein-like
SynonymsLOC381387, LOC381388, 4930519N13Rik
MMRRC Submission 042922-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5343 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150934519-151039382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150971190 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 182 (E182G)
Ref Sequence ENSEMBL: ENSMUSP00000105522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109896] [ENSMUST00000128627] [ENSMUST00000150595]
Predicted Effect probably benign
Transcript: ENSMUST00000109896
AA Change: E182G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105522
Gene: ENSMUSG00000068115
AA Change: E182G

DomainStartEndE-ValueType
EFh 12 40 6.56e0 SMART
low complexity region 76 93 N/A INTRINSIC
EFh 201 229 4.45e1 SMART
EFh 238 266 8.98e-4 SMART
low complexity region 295 306 N/A INTRINSIC
coiled coil region 381 423 N/A INTRINSIC
coiled coil region 461 517 N/A INTRINSIC
coiled coil region 541 584 N/A INTRINSIC
coiled coil region 620 699 N/A INTRINSIC
coiled coil region 728 751 N/A INTRINSIC
coiled coil region 835 863 N/A INTRINSIC
coiled coil region 1058 1334 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128564
Predicted Effect probably benign
Transcript: ENSMUST00000128627
SMART Domains Protein: ENSMUSP00000121872
Gene: ENSMUSG00000068115

DomainStartEndE-ValueType
SCOP:d1c07a_ 3 76 3e-7 SMART
PDB:2PMY|B 10 75 1e-6 PDB
Blast:EFh 12 40 4e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149979
Predicted Effect probably benign
Transcript: ENSMUST00000150595
SMART Domains Protein: ENSMUSP00000117001
Gene: ENSMUSG00000068115

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
coiled coil region 85 122 N/A INTRINSIC
coiled coil region 160 216 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit bone-marrow myeloid hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik C A 17: 46,773,036 A75E probably damaging Het
5730559C18Rik G T 1: 136,225,442 H237Q probably benign Het
Adck5 G A 15: 76,595,580 R560H probably damaging Het
Ahctf1 A T 1: 179,770,634 Y964* probably null Het
Alg8 T C 7: 97,386,919 I339T possibly damaging Het
Alox5 T C 6: 116,413,507 D503G possibly damaging Het
Camk4 A G 18: 33,078,069 T76A probably damaging Het
Cdh3 T C 8: 106,552,936 V728A probably benign Het
Chd4 T A 6: 125,120,363 N1326K probably damaging Het
Cnn1 A T 9: 22,105,410 Y48F probably benign Het
Dnah6 T A 6: 73,212,616 E16D probably benign Het
Ezh2 A G 6: 47,576,615 L56S probably damaging Het
F13b T C 1: 139,510,544 V299A possibly damaging Het
Hydin T C 8: 110,485,419 S1279P probably benign Het
Ift172 T C 5: 31,263,812 M981V probably benign Het
Lpl T A 8: 68,895,737 V206E probably damaging Het
Mre11a A G 9: 14,811,834 D368G probably damaging Het
Mreg G A 1: 72,160,958 P191L probably damaging Het
Mtif2 G T 11: 29,536,964 A134S probably damaging Het
Mxd4 T C 5: 34,177,730 S114G probably benign Het
Myo1b T C 1: 51,778,537 Q522R probably benign Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Notch3 T C 17: 32,143,283 N1456S probably benign Het
Npr1 G T 3: 90,458,208 N648K possibly damaging Het
Oas3 A G 5: 120,756,238 S1016P possibly damaging Het
Olfr1499 T C 19: 13,814,960 N210S probably damaging Het
Olfr518 C T 7: 108,880,998 V203M possibly damaging Het
Palld A G 8: 61,549,815 probably benign Het
Patj T G 4: 98,676,193 I1021S probably damaging Het
Pfpl T A 19: 12,428,688 L101Q probably damaging Het
Pilrb2 T A 5: 137,870,966 E124V possibly damaging Het
Pomk A G 8: 25,983,016 F303S probably benign Het
Rap1gap2 A T 11: 74,441,785 S65T probably damaging Het
Sema3a G A 5: 13,473,406 C114Y probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Spry4 A T 18: 38,589,975 V245E probably damaging Het
Srrt T C 5: 137,297,165 Y271C probably damaging Het
Tas2r136 A G 6: 132,778,080 V28A probably benign Het
Tenm2 A G 11: 36,069,503 V998A probably benign Het
Trim37 A G 11: 87,137,603 E46G probably damaging Het
Ubiad1 A G 4: 148,436,435 V244A possibly damaging Het
Other mutations in Ninl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ninl APN 2 150966241 missense probably damaging 0.98
IGL01697:Ninl APN 2 150939947 missense probably damaging 1.00
IGL01756:Ninl APN 2 150979516 missense probably damaging 1.00
IGL01925:Ninl APN 2 150971059 missense probably damaging 1.00
IGL02341:Ninl APN 2 150944605 nonsense probably null
IGL02838:Ninl APN 2 150955711 splice site probably null
IGL02868:Ninl APN 2 150937054 missense probably benign
IGL03116:Ninl APN 2 150964219 missense probably damaging 1.00
IGL03396:Ninl APN 2 150966212 missense possibly damaging 0.88
R0117:Ninl UTSW 2 150937673 missense probably damaging 0.98
R0685:Ninl UTSW 2 150939855 missense possibly damaging 0.73
R0928:Ninl UTSW 2 150963475 missense probably damaging 0.99
R1051:Ninl UTSW 2 150970126 missense probably damaging 1.00
R1441:Ninl UTSW 2 150971124 missense probably benign 0.10
R1493:Ninl UTSW 2 150980095 missense probably damaging 1.00
R1499:Ninl UTSW 2 150980176 missense possibly damaging 0.70
R1539:Ninl UTSW 2 150975947 missense probably damaging 1.00
R1658:Ninl UTSW 2 150964159 missense probably damaging 1.00
R2038:Ninl UTSW 2 150975843 nonsense probably null
R2156:Ninl UTSW 2 150944583 missense probably damaging 1.00
R2232:Ninl UTSW 2 150950050 missense probably benign 0.00
R2373:Ninl UTSW 2 150980117 missense probably damaging 1.00
R3743:Ninl UTSW 2 150950248 missense probably benign 0.01
R3906:Ninl UTSW 2 150980119 missense probably damaging 1.00
R3950:Ninl UTSW 2 150952488 missense possibly damaging 0.90
R4283:Ninl UTSW 2 150953416 unclassified probably benign
R4798:Ninl UTSW 2 150959881 nonsense probably null
R4963:Ninl UTSW 2 150939909 missense probably benign 0.04
R4998:Ninl UTSW 2 150953364 missense probably damaging 1.00
R5810:Ninl UTSW 2 150950168 missense probably benign 0.31
R5825:Ninl UTSW 2 150940724 missense probably damaging 1.00
R6436:Ninl UTSW 2 150966178 missense probably damaging 1.00
R6728:Ninl UTSW 2 150975857 nonsense probably null
R6734:Ninl UTSW 2 150945083 critical splice donor site probably null
R6997:Ninl UTSW 2 150966225 missense probably benign 0.08
R7135:Ninl UTSW 2 150955604 missense probably benign 0.00
R7157:Ninl UTSW 2 150949343 missense possibly damaging 0.63
R7315:Ninl UTSW 2 150950050 missense probably benign 0.00
R7840:Ninl UTSW 2 150966096 missense probably benign 0.00
R7923:Ninl UTSW 2 150966096 missense probably benign 0.00
X0062:Ninl UTSW 2 150970046 missense probably damaging 1.00
Z1177:Ninl UTSW 2 150953398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGTACTCAATGTGACCGC -3'
(R):5'- GGAATACTCCAGCTTGGCTC -3'

Sequencing Primer
(F):5'- CTACAAATACCATGACACTGAGGTGG -3'
(R):5'- AGCTTGGCTCTCCATGGAG -3'
Posted On2016-08-04