Incidental Mutation 'R5343:Ift172'
ID422432
Institutional Source Beutler Lab
Gene Symbol Ift172
Ensembl Gene ENSMUSG00000038564
Gene Nameintraflagellar transport 172
Synonymswim
MMRRC Submission 042922-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5343 (G1)
Quality Score217
Status Not validated
Chromosome5
Chromosomal Location31253277-31291116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31263812 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 981 (M981V)
Ref Sequence ENSEMBL: ENSMUSP00000049335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041565]
Predicted Effect probably benign
Transcript: ENSMUST00000041565
AA Change: M981V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564
AA Change: M981V

DomainStartEndE-ValueType
WD40 2 44 6e-3 SMART
WD40 55 94 2.22e0 SMART
WD40 102 139 1.23e2 SMART
WD40 141 180 4.6e0 SMART
WD40 186 223 3.3e1 SMART
WD40 225 267 4.42e1 SMART
WD40 279 314 1.03e1 SMART
Blast:WD40 516 550 5e-13 BLAST
low complexity region 573 588 N/A INTRINSIC
internal_repeat_1 625 1026 1.7e-10 PROSPERO
Blast:TPR 1029 1062 2e-13 BLAST
low complexity region 1077 1091 N/A INTRINSIC
internal_repeat_1 1101 1498 1.7e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201953
Predicted Effect probably benign
Transcript: ENSMUST00000202585
SMART Domains Protein: ENSMUSP00000144216
Gene: ENSMUSG00000038564

DomainStartEndE-ValueType
Blast:WD40 46 78 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the intraflagellar transport subcomplex IFT-B. Subcomplexes IFT-A and IFT-B are necessary for ciliary assembly and maintenance. Mutations in this gene have been associated with skeletal ciliopathies, with or without polydactyly, such as such short-rib thoracic dysplasias 1, 9 or 10. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis, neural tube defects, and developmental patterning abnormalities. Mice homozygous for a conditional allele activated in the early limb bud exhibit polydactyly and short limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik C A 17: 46,773,036 A75E probably damaging Het
5730559C18Rik G T 1: 136,225,442 H237Q probably benign Het
Adck5 G A 15: 76,595,580 R560H probably damaging Het
Ahctf1 A T 1: 179,770,634 Y964* probably null Het
Alg8 T C 7: 97,386,919 I339T possibly damaging Het
Alox5 T C 6: 116,413,507 D503G possibly damaging Het
Camk4 A G 18: 33,078,069 T76A probably damaging Het
Cdh3 T C 8: 106,552,936 V728A probably benign Het
Chd4 T A 6: 125,120,363 N1326K probably damaging Het
Cnn1 A T 9: 22,105,410 Y48F probably benign Het
Dnah6 T A 6: 73,212,616 E16D probably benign Het
Ezh2 A G 6: 47,576,615 L56S probably damaging Het
F13b T C 1: 139,510,544 V299A possibly damaging Het
Hydin T C 8: 110,485,419 S1279P probably benign Het
Lpl T A 8: 68,895,737 V206E probably damaging Het
Mre11a A G 9: 14,811,834 D368G probably damaging Het
Mreg G A 1: 72,160,958 P191L probably damaging Het
Mtif2 G T 11: 29,536,964 A134S probably damaging Het
Mxd4 T C 5: 34,177,730 S114G probably benign Het
Myo1b T C 1: 51,778,537 Q522R probably benign Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Ninl T C 2: 150,971,190 E182G probably benign Het
Notch3 T C 17: 32,143,283 N1456S probably benign Het
Npr1 G T 3: 90,458,208 N648K possibly damaging Het
Oas3 A G 5: 120,756,238 S1016P possibly damaging Het
Olfr1499 T C 19: 13,814,960 N210S probably damaging Het
Olfr518 C T 7: 108,880,998 V203M possibly damaging Het
Palld A G 8: 61,549,815 probably benign Het
Patj T G 4: 98,676,193 I1021S probably damaging Het
Pfpl T A 19: 12,428,688 L101Q probably damaging Het
Pilrb2 T A 5: 137,870,966 E124V possibly damaging Het
Pomk A G 8: 25,983,016 F303S probably benign Het
Rap1gap2 A T 11: 74,441,785 S65T probably damaging Het
Sema3a G A 5: 13,473,406 C114Y probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Spry4 A T 18: 38,589,975 V245E probably damaging Het
Srrt T C 5: 137,297,165 Y271C probably damaging Het
Tas2r136 A G 6: 132,778,080 V28A probably benign Het
Tenm2 A G 11: 36,069,503 V998A probably benign Het
Trim37 A G 11: 87,137,603 E46G probably damaging Het
Ubiad1 A G 4: 148,436,435 V244A possibly damaging Het
Other mutations in Ift172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ift172 APN 5 31275896 missense probably damaging 1.00
IGL01399:Ift172 APN 5 31266248 missense probably benign
IGL01405:Ift172 APN 5 31261852 nonsense probably null
IGL01562:Ift172 APN 5 31267247 missense probably damaging 0.97
IGL01758:Ift172 APN 5 31280714 missense probably benign
IGL01792:Ift172 APN 5 31276871 missense probably damaging 1.00
IGL01830:Ift172 APN 5 31285292 missense probably damaging 1.00
IGL01839:Ift172 APN 5 31266350 missense probably damaging 1.00
IGL02007:Ift172 APN 5 31286604 missense probably benign 0.17
IGL02172:Ift172 APN 5 31281337 splice site probably benign
IGL02190:Ift172 APN 5 31254458 missense possibly damaging 0.51
IGL02334:Ift172 APN 5 31283058 missense probably benign 0.00
IGL02486:Ift172 APN 5 31257583 missense probably damaging 1.00
IGL02517:Ift172 APN 5 31253648 unclassified probably null
IGL02571:Ift172 APN 5 31257891 missense probably damaging 1.00
IGL02626:Ift172 APN 5 31264496 missense probably benign
IGL03183:Ift172 APN 5 31272004 missense probably benign 0.06
IGL03277:Ift172 APN 5 31267298 missense possibly damaging 0.92
IGL03349:Ift172 APN 5 31284130 missense probably benign 0.05
ostinato UTSW 5 31276940 missense probably benign 0.10
pushback UTSW 5 31286945 missense probably damaging 1.00
P0042:Ift172 UTSW 5 31261455 missense probably benign 0.35
PIT4802001:Ift172 UTSW 5 31285266 missense probably benign 0.03
R0153:Ift172 UTSW 5 31260624 missense probably benign
R0328:Ift172 UTSW 5 31263851 nonsense probably null
R0357:Ift172 UTSW 5 31257900 missense possibly damaging 0.51
R0369:Ift172 UTSW 5 31253641 missense probably damaging 1.00
R0391:Ift172 UTSW 5 31286667 missense probably damaging 1.00
R0512:Ift172 UTSW 5 31285477 missense possibly damaging 0.92
R0546:Ift172 UTSW 5 31257601 missense probably benign 0.14
R0553:Ift172 UTSW 5 31275842 splice site probably benign
R0606:Ift172 UTSW 5 31254313 missense probably damaging 0.99
R0834:Ift172 UTSW 5 31257371 missense probably benign
R0973:Ift172 UTSW 5 31265355 missense probably benign
R0973:Ift172 UTSW 5 31257918 unclassified probably benign
R1189:Ift172 UTSW 5 31285830 critical splice acceptor site probably null
R1205:Ift172 UTSW 5 31285792 missense probably benign
R1289:Ift172 UTSW 5 31280976 missense probably damaging 0.98
R1342:Ift172 UTSW 5 31261866 missense probably benign
R1395:Ift172 UTSW 5 31285238 unclassified probably benign
R1417:Ift172 UTSW 5 31256649 missense probably damaging 1.00
R2020:Ift172 UTSW 5 31267241 nonsense probably null
R2111:Ift172 UTSW 5 31286079 missense probably benign 0.04
R2175:Ift172 UTSW 5 31266685 missense probably damaging 1.00
R2509:Ift172 UTSW 5 31262968 missense probably benign
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R3705:Ift172 UTSW 5 31261437 critical splice donor site probably null
R3793:Ift172 UTSW 5 31257581 missense possibly damaging 0.61
R4385:Ift172 UTSW 5 31286967 missense probably damaging 1.00
R4477:Ift172 UTSW 5 31265437 missense probably benign 0.38
R4590:Ift172 UTSW 5 31253955 missense probably damaging 1.00
R4663:Ift172 UTSW 5 31284215 missense probably benign 0.01
R4665:Ift172 UTSW 5 31285254 missense possibly damaging 0.82
R4977:Ift172 UTSW 5 31272116 missense possibly damaging 0.79
R5109:Ift172 UTSW 5 31265986 missense probably benign 0.06
R5182:Ift172 UTSW 5 31267614 missense possibly damaging 0.51
R5465:Ift172 UTSW 5 31261518 splice site probably null
R5622:Ift172 UTSW 5 31283082 missense probably damaging 1.00
R5718:Ift172 UTSW 5 31255277 missense possibly damaging 0.94
R5793:Ift172 UTSW 5 31276948 missense possibly damaging 0.96
R5870:Ift172 UTSW 5 31276940 missense probably benign 0.10
R5919:Ift172 UTSW 5 31260662 missense possibly damaging 0.63
R5968:Ift172 UTSW 5 31261484 missense probably damaging 1.00
R6112:Ift172 UTSW 5 31256897 missense probably benign
R6339:Ift172 UTSW 5 31256583 missense probably benign 0.00
R6339:Ift172 UTSW 5 31286945 missense probably damaging 1.00
R6355:Ift172 UTSW 5 31284157 missense probably benign 0.33
R6565:Ift172 UTSW 5 31275883 missense possibly damaging 0.68
R6668:Ift172 UTSW 5 31255339 missense probably benign 0.00
R6755:Ift172 UTSW 5 31260998 nonsense probably null
R6818:Ift172 UTSW 5 31265960 missense probably benign 0.01
R6939:Ift172 UTSW 5 31257586 missense probably damaging 1.00
R6980:Ift172 UTSW 5 31257386 missense probably benign
R7047:Ift172 UTSW 5 31275894 nonsense probably null
R7156:Ift172 UTSW 5 31272075 missense probably damaging 1.00
R7180:Ift172 UTSW 5 31254262 missense probably damaging 1.00
R7288:Ift172 UTSW 5 31285286 missense probably damaging 1.00
R7351:Ift172 UTSW 5 31275896 missense probably damaging 1.00
R7706:Ift172 UTSW 5 31266379 nonsense probably null
R7890:Ift172 UTSW 5 31283081 nonsense probably null
R7973:Ift172 UTSW 5 31283081 nonsense probably null
X0022:Ift172 UTSW 5 31285320 missense probably damaging 0.97
Z1176:Ift172 UTSW 5 31276924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATGTCGTCATACAACTTGTGC -3'
(R):5'- GCCTCACAGTCTAGATCATGTC -3'

Sequencing Primer
(F):5'- CAACTTGTGCTTTTTGAACATGG -3'
(R):5'- CACAGTCTAGATCATGTCTTAGCAG -3'
Posted On2016-08-04