Incidental Mutation 'R5343:Srrt'
ID 422436
Institutional Source Beutler Lab
Gene Symbol Srrt
Ensembl Gene ENSMUSG00000037364
Gene Name serrate RNA effector molecule homolog (Arabidopsis)
Synonyms Asr2, Ars2, 2810019G02Rik
MMRRC Submission 042922-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5343 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 137293966-137305936 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 137295427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 271 (Y271C)
Ref Sequence ENSEMBL: ENSMUSP00000142351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000040873] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000196109] [ENSMUST00000197466] [ENSMUST00000199243] [ENSMUST00000198526] [ENSMUST00000196208]
AlphaFold Q99MR6
Predicted Effect probably benign
Transcript: ENSMUST00000024099
SMART Domains Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 14 563 2e-186 PFAM
Pfam:Abhydrolase_3 146 276 7.5e-9 PFAM
Pfam:AChE_tetra 578 614 3.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040873
AA Change: Y629C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364
AA Change: Y629C

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052825
SMART Domains Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

DomainStartEndE-ValueType
Pfam:Peptidase_C78 27 212 5.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085934
SMART Domains Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 15 563 3e-178 PFAM
Pfam:Abhydrolase_3 146 260 1.4e-7 PFAM
Pfam:AChE_tetra 578 613 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184134
Predicted Effect probably damaging
Transcript: ENSMUST00000196109
AA Change: Y271C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364
AA Change: Y271C

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197144
Predicted Effect probably damaging
Transcript: ENSMUST00000197466
AA Change: Y629C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364
AA Change: Y629C

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199243
AA Change: Y629C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364
AA Change: Y629C

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184197
Predicted Effect probably benign
Transcript: ENSMUST00000198526
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196208
SMART Domains Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 14 359 6.5e-134 PFAM
Pfam:Abhydrolase_3 146 284 4.1e-7 PFAM
Pfam:COesterase 355 475 1.5e-25 PFAM
Pfam:AChE_tetra 490 526 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200643
Predicted Effect unknown
Transcript: ENSMUST00000199756
AA Change: Y51C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199473
Predicted Effect probably benign
Transcript: ENSMUST00000223263
Predicted Effect probably benign
Transcript: ENSMUST00000199365
Predicted Effect probably benign
Transcript: ENSMUST00000199605
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation, increased apoptosis, and when cultured most fail to hatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik C A 17: 47,083,962 (GRCm39) A75E probably damaging Het
Adck5 G A 15: 76,479,780 (GRCm39) R560H probably damaging Het
Ahctf1 A T 1: 179,598,199 (GRCm39) Y964* probably null Het
Alg8 T C 7: 97,036,126 (GRCm39) I339T possibly damaging Het
Alox5 T C 6: 116,390,468 (GRCm39) D503G possibly damaging Het
Camk4 A G 18: 33,211,122 (GRCm39) T76A probably damaging Het
Cdh3 T C 8: 107,279,568 (GRCm39) V728A probably benign Het
Chd4 T A 6: 125,097,326 (GRCm39) N1326K probably damaging Het
Cnn1 A T 9: 22,016,706 (GRCm39) Y48F probably benign Het
Dnah6 T A 6: 73,189,599 (GRCm39) E16D probably benign Het
Ezh2 A G 6: 47,553,549 (GRCm39) L56S probably damaging Het
F13b T C 1: 139,438,282 (GRCm39) V299A possibly damaging Het
Hydin T C 8: 111,212,051 (GRCm39) S1279P probably benign Het
Ift172 T C 5: 31,421,156 (GRCm39) M981V probably benign Het
Inava G T 1: 136,153,180 (GRCm39) H237Q probably benign Het
Lpl T A 8: 69,348,389 (GRCm39) V206E probably damaging Het
Mre11a A G 9: 14,723,130 (GRCm39) D368G probably damaging Het
Mreg G A 1: 72,200,117 (GRCm39) P191L probably damaging Het
Mtif2 G T 11: 29,486,964 (GRCm39) A134S probably damaging Het
Mxd4 T C 5: 34,335,074 (GRCm39) S114G probably benign Het
Myo1b T C 1: 51,817,696 (GRCm39) Q522R probably benign Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 26,999,349 (GRCm39) probably benign Het
Ninl T C 2: 150,813,110 (GRCm39) E182G probably benign Het
Notch3 T C 17: 32,362,257 (GRCm39) N1456S probably benign Het
Npr1 G T 3: 90,365,515 (GRCm39) N648K possibly damaging Het
Oas3 A G 5: 120,894,303 (GRCm39) S1016P possibly damaging Het
Or10a3 C T 7: 108,480,205 (GRCm39) V203M possibly damaging Het
Or9i14 T C 19: 13,792,324 (GRCm39) N210S probably damaging Het
Palld A G 8: 62,002,849 (GRCm39) probably benign Het
Patj T G 4: 98,564,430 (GRCm39) I1021S probably damaging Het
Pfpl T A 19: 12,406,052 (GRCm39) L101Q probably damaging Het
Pilrb2 T A 5: 137,869,228 (GRCm39) E124V possibly damaging Het
Pomk A G 8: 26,473,044 (GRCm39) F303S probably benign Het
Rap1gap2 A T 11: 74,332,611 (GRCm39) S65T probably damaging Het
Sema3a G A 5: 13,523,373 (GRCm39) C114Y probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,103,384 (GRCm39) probably benign Het
Spry4 A T 18: 38,723,028 (GRCm39) V245E probably damaging Het
Tas2r136 A G 6: 132,755,043 (GRCm39) V28A probably benign Het
Tenm2 A G 11: 35,960,330 (GRCm39) V998A probably benign Het
Trim37 A G 11: 87,028,429 (GRCm39) E46G probably damaging Het
Ubiad1 A G 4: 148,520,892 (GRCm39) V244A possibly damaging Het
Other mutations in Srrt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Srrt APN 5 137,294,240 (GRCm39) unclassified probably benign
IGL01062:Srrt APN 5 137,294,569 (GRCm39) missense probably damaging 1.00
IGL02227:Srrt APN 5 137,294,536 (GRCm39) missense probably damaging 1.00
IGL02656:Srrt APN 5 137,297,938 (GRCm39) unclassified probably benign
IGL03105:Srrt APN 5 137,298,106 (GRCm39) missense possibly damaging 0.72
IGL03137:Srrt APN 5 137,294,379 (GRCm39) unclassified probably benign
R0281:Srrt UTSW 5 137,294,389 (GRCm39) unclassified probably benign
R0322:Srrt UTSW 5 137,294,870 (GRCm39) missense probably damaging 1.00
R0347:Srrt UTSW 5 137,297,938 (GRCm39) unclassified probably benign
R1253:Srrt UTSW 5 137,298,598 (GRCm39) missense probably benign 0.01
R1397:Srrt UTSW 5 137,298,523 (GRCm39) missense possibly damaging 0.89
R1520:Srrt UTSW 5 137,297,028 (GRCm39) missense probably damaging 0.99
R1561:Srrt UTSW 5 137,298,281 (GRCm39) missense probably benign 0.24
R1645:Srrt UTSW 5 137,300,401 (GRCm39) nonsense probably null
R1759:Srrt UTSW 5 137,301,212 (GRCm39) missense probably damaging 1.00
R1770:Srrt UTSW 5 137,298,122 (GRCm39) unclassified probably benign
R1795:Srrt UTSW 5 137,301,274 (GRCm39) unclassified probably benign
R1848:Srrt UTSW 5 137,295,207 (GRCm39) missense probably damaging 1.00
R3838:Srrt UTSW 5 137,300,387 (GRCm39) critical splice donor site probably null
R5015:Srrt UTSW 5 137,294,271 (GRCm39) missense probably damaging 1.00
R5068:Srrt UTSW 5 137,294,803 (GRCm39) missense possibly damaging 0.93
R5163:Srrt UTSW 5 137,295,035 (GRCm39) critical splice donor site probably null
R5316:Srrt UTSW 5 137,294,813 (GRCm39) missense probably benign 0.16
R5351:Srrt UTSW 5 137,296,546 (GRCm39) makesense probably null
R5412:Srrt UTSW 5 137,294,549 (GRCm39) missense probably damaging 1.00
R5806:Srrt UTSW 5 137,296,179 (GRCm39) missense probably damaging 0.98
R6470:Srrt UTSW 5 137,300,918 (GRCm39) missense probably damaging 1.00
R6497:Srrt UTSW 5 137,295,768 (GRCm39) missense probably damaging 1.00
R6755:Srrt UTSW 5 137,301,192 (GRCm39) missense probably damaging 1.00
R6828:Srrt UTSW 5 137,295,230 (GRCm39) missense probably damaging 1.00
R6875:Srrt UTSW 5 137,296,935 (GRCm39) missense probably benign 0.00
R7586:Srrt UTSW 5 137,300,457 (GRCm39) missense probably damaging 0.98
R7677:Srrt UTSW 5 137,298,410 (GRCm39) missense probably damaging 0.99
R8028:Srrt UTSW 5 137,300,760 (GRCm39) critical splice donor site probably benign
R8413:Srrt UTSW 5 137,298,589 (GRCm39) missense possibly damaging 0.84
R8438:Srrt UTSW 5 137,301,262 (GRCm39) missense unknown
R8795:Srrt UTSW 5 137,298,238 (GRCm39) missense probably benign 0.17
R8925:Srrt UTSW 5 137,297,070 (GRCm39) missense probably benign 0.26
R8927:Srrt UTSW 5 137,297,070 (GRCm39) missense probably benign 0.26
R9024:Srrt UTSW 5 137,301,291 (GRCm39) missense unknown
R9632:Srrt UTSW 5 137,296,689 (GRCm39) missense possibly damaging 0.79
R9667:Srrt UTSW 5 137,295,732 (GRCm39) missense probably damaging 0.96
R9793:Srrt UTSW 5 137,294,835 (GRCm39) missense probably benign 0.37
RF018:Srrt UTSW 5 137,298,262 (GRCm39) missense probably benign 0.23
Z1176:Srrt UTSW 5 137,296,489 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATGTCTTCTGCCACTCCAG -3'
(R):5'- AGCTGATCAAGGTGCCAGTTC -3'

Sequencing Primer
(F):5'- TCCAGCACTGTGTGGGTGAC -3'
(R):5'- AGTTCCGACCATCTGGAGCATG -3'
Posted On 2016-08-04