Incidental Mutation 'R5343:Alg8'
ID422444
Institutional Source Beutler Lab
Gene Symbol Alg8
Ensembl Gene ENSMUSG00000035704
Gene Nameasparagine-linked glycosylation 8 (alpha-1,3-glucosyltransferase)
SynonymsLOC381903
MMRRC Submission 042922-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5343 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location97371606-97392185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97386919 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 339 (I339T)
Ref Sequence ENSEMBL: ENSMUSP00000095901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098300
AA Change: I339T

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095901
Gene: ENSMUSG00000035704
AA Change: I339T

DomainStartEndE-ValueType
Pfam:Alg6_Alg8 21 510 1.3e-165 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154107
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALG6/ALG8 glucosyltransferase family. The encoded protein catalyzes the addition of the second glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation of proteins. Mutations in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ih). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik C A 17: 46,773,036 A75E probably damaging Het
5730559C18Rik G T 1: 136,225,442 H237Q probably benign Het
Adck5 G A 15: 76,595,580 R560H probably damaging Het
Ahctf1 A T 1: 179,770,634 Y964* probably null Het
Alox5 T C 6: 116,413,507 D503G possibly damaging Het
Camk4 A G 18: 33,078,069 T76A probably damaging Het
Cdh3 T C 8: 106,552,936 V728A probably benign Het
Chd4 T A 6: 125,120,363 N1326K probably damaging Het
Cnn1 A T 9: 22,105,410 Y48F probably benign Het
Dnah6 T A 6: 73,212,616 E16D probably benign Het
Ezh2 A G 6: 47,576,615 L56S probably damaging Het
F13b T C 1: 139,510,544 V299A possibly damaging Het
Hydin T C 8: 110,485,419 S1279P probably benign Het
Ift172 T C 5: 31,263,812 M981V probably benign Het
Lpl T A 8: 68,895,737 V206E probably damaging Het
Mre11a A G 9: 14,811,834 D368G probably damaging Het
Mreg G A 1: 72,160,958 P191L probably damaging Het
Mtif2 G T 11: 29,536,964 A134S probably damaging Het
Mxd4 T C 5: 34,177,730 S114G probably benign Het
Myo1b T C 1: 51,778,537 Q522R probably benign Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Ninl T C 2: 150,971,190 E182G probably benign Het
Notch3 T C 17: 32,143,283 N1456S probably benign Het
Npr1 G T 3: 90,458,208 N648K possibly damaging Het
Oas3 A G 5: 120,756,238 S1016P possibly damaging Het
Olfr1499 T C 19: 13,814,960 N210S probably damaging Het
Olfr518 C T 7: 108,880,998 V203M possibly damaging Het
Palld A G 8: 61,549,815 probably benign Het
Patj T G 4: 98,676,193 I1021S probably damaging Het
Pfpl T A 19: 12,428,688 L101Q probably damaging Het
Pilrb2 T A 5: 137,870,966 E124V possibly damaging Het
Pomk A G 8: 25,983,016 F303S probably benign Het
Rap1gap2 A T 11: 74,441,785 S65T probably damaging Het
Sema3a G A 5: 13,473,406 C114Y probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Spry4 A T 18: 38,589,975 V245E probably damaging Het
Srrt T C 5: 137,297,165 Y271C probably damaging Het
Tas2r136 A G 6: 132,778,080 V28A probably benign Het
Tenm2 A G 11: 36,069,503 V998A probably benign Het
Trim37 A G 11: 87,137,603 E46G probably damaging Het
Ubiad1 A G 4: 148,436,435 V244A possibly damaging Het
Other mutations in Alg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Alg8 APN 7 97378176 missense possibly damaging 0.81
IGL02349:Alg8 APN 7 97379894 missense possibly damaging 0.95
IGL02441:Alg8 APN 7 97380297 missense probably benign 0.04
R0238:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0238:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0239:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0239:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R1109:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R1429:Alg8 UTSW 7 97390292 missense probably benign 0.18
R3838:Alg8 UTSW 7 97388545 missense probably damaging 1.00
R5622:Alg8 UTSW 7 97386799 splice site probably benign
R5910:Alg8 UTSW 7 97390286 missense possibly damaging 0.67
R5963:Alg8 UTSW 7 97379830 missense probably benign 0.00
R6484:Alg8 UTSW 7 97382928 missense probably benign
R6735:Alg8 UTSW 7 97382982 missense probably benign 0.05
R7896:Alg8 UTSW 7 97390916 missense probably damaging 1.00
R7979:Alg8 UTSW 7 97390916 missense probably damaging 1.00
Z1176:Alg8 UTSW 7 97383761 missense probably benign 0.01
Z1177:Alg8 UTSW 7 97371662 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGACCTGACTCATGAGCTATGG -3'
(R):5'- TCACAGAGGCTTTCCTGGTAATC -3'

Sequencing Primer
(F):5'- CTGACTCATGAGCTATGGAATCC -3'
(R):5'- GTTCTCTGAGAATTGCTAGGAAATGC -3'
Posted On2016-08-04