Mutagenetix > Incidental Mutations

Incidental Mutation 'R5343:Alg8'

422444

Institutional Source

Beutler Lab

Gene Symbol

Alg8

Ensembl Gene

ENSMUSG00000035704

Gene Name

asparagine-linked glycosylation 8 (alpha-1,3-glucosyltransferase)

Synonyms

LOC381903

MMRRC Submission

042922-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5343 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97371606-97392185 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 97386919 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 339 (I339T)

Ref Sequence

ENSEMBL: ENSMUSP00000095901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098300]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098300
AA Change: I339T

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000095901
Gene: ENSMUSG00000035704
AA Change: I339T

Domain	Start	End	E-Value	Type
Pfam:Alg6_Alg8	21	510	1.3e-165	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130111

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137105

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147297

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149031

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154107

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALG6/ALG8 glucosyltransferase family. The encoded protein catalyzes the addition of the second glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation of proteins. Mutations in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ih). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310039H08Rik	C	A	17: 46,773,036	A75E	probably damaging	Het
5730559C18Rik	G	T	1: 136,225,442	H237Q	probably benign	Het
Adck5	G	A	15: 76,595,580	R560H	probably damaging	Het
Ahctf1	A	T	1: 179,770,634	Y964*	probably null	Het
Alox5	T	C	6: 116,413,507	D503G	possibly damaging	Het
Camk4	A	G	18: 33,078,069	T76A	probably damaging	Het
Cdh3	T	C	8: 106,552,936	V728A	probably benign	Het
Chd4	T	A	6: 125,120,363	N1326K	probably damaging	Het
Cnn1	A	T	9: 22,105,410	Y48F	probably benign	Het
Dnah6	T	A	6: 73,212,616	E16D	probably benign	Het
Ezh2	A	G	6: 47,576,615	L56S	probably damaging	Het
F13b	T	C	1: 139,510,544	V299A	possibly damaging	Het
Hydin	T	C	8: 110,485,419	S1279P	probably benign	Het
Ift172	T	C	5: 31,263,812	M981V	probably benign	Het
Lpl	T	A	8: 68,895,737	V206E	probably damaging	Het
Mre11a	A	G	9: 14,811,834	D368G	probably damaging	Het
Mreg	G	A	1: 72,160,958	P191L	probably damaging	Het
Mtif2	G	T	11: 29,536,964	A134S	probably damaging	Het
Mxd4	T	C	5: 34,177,730	S114G	probably benign	Het
Myo1b	T	C	1: 51,778,537	Q522R	probably benign	Het
Ncapd3	GGCTGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTGCTG	9: 27,088,053		probably benign	Het
Ninl	T	C	2: 150,971,190	E182G	probably benign	Het
Notch3	T	C	17: 32,143,283	N1456S	probably benign	Het
Npr1	G	T	3: 90,458,208	N648K	possibly damaging	Het
Oas3	A	G	5: 120,756,238	S1016P	possibly damaging	Het
Olfr1499	T	C	19: 13,814,960	N210S	probably damaging	Het
Olfr518	C	T	7: 108,880,998	V203M	possibly damaging	Het
Palld	A	G	8: 61,549,815		probably benign	Het
Patj	T	G	4: 98,676,193	I1021S	probably damaging	Het
Pfpl	T	A	19: 12,428,688	L101Q	probably damaging	Het
Pilrb2	T	A	5: 137,870,966	E124V	possibly damaging	Het
Pomk	A	G	8: 25,983,016	F303S	probably benign	Het
Rap1gap2	A	T	11: 74,441,785	S65T	probably damaging	Het
Sema3a	G	A	5: 13,473,406	C114Y	probably damaging	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Spry4	A	T	18: 38,589,975	V245E	probably damaging	Het
Srrt	T	C	5: 137,297,165	Y271C	probably damaging	Het
Tas2r136	A	G	6: 132,778,080	V28A	probably benign	Het
Tenm2	A	G	11: 36,069,503	V998A	probably benign	Het
Trim37	A	G	11: 87,137,603	E46G	probably damaging	Het
Ubiad1	A	G	4: 148,436,435	V244A	possibly damaging	Het

Other mutations in Alg8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Alg8	APN	7	97378176	missense	possibly damaging	0.81
IGL02349:Alg8	APN	7	97379894	missense	possibly damaging	0.95
IGL02441:Alg8	APN	7	97380297	missense	probably benign	0.04
R0238:Alg8	UTSW	7	97383684	critical splice acceptor site	probably null
R0238:Alg8	UTSW	7	97383684	critical splice acceptor site	probably null
R0239:Alg8	UTSW	7	97383684	critical splice acceptor site	probably null
R0239:Alg8	UTSW	7	97383684	critical splice acceptor site	probably null
R1109:Alg8	UTSW	7	97383684	critical splice acceptor site	probably null
R1429:Alg8	UTSW	7	97390292	missense	probably benign	0.18
R3838:Alg8	UTSW	7	97388545	missense	probably damaging	1.00
R5622:Alg8	UTSW	7	97386799	splice site	probably benign
R5910:Alg8	UTSW	7	97390286	missense	possibly damaging	0.67
R5963:Alg8	UTSW	7	97379830	missense	probably benign	0.00
R6484:Alg8	UTSW	7	97382928	missense	probably benign
R6735:Alg8	UTSW	7	97382982	missense	probably benign	0.05
R7896:Alg8	UTSW	7	97390916	missense	probably damaging	1.00
R7957:Alg8	UTSW	7	97390924	missense	probably benign	0.04
R7958:Alg8	UTSW	7	97386921	missense	possibly damaging	0.65
Z1176:Alg8	UTSW	7	97383761	missense	probably benign	0.01
Z1177:Alg8	UTSW	7	97371662	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGACCTGACTCATGAGCTATGG -3'
(R):5'- TCACAGAGGCTTTCCTGGTAATC -3'

Sequencing Primer
(F):5'- CTGACTCATGAGCTATGGAATCC -3'
(R):5'- GTTCTCTGAGAATTGCTAGGAAATGC -3'

Posted On

2016-08-04