Mutagenetix > Incidental Mutation

Incidental Mutation 'R5343:Palld'

422447

Institutional Source

Beutler Lab

Gene Symbol

Palld

Ensembl Gene

ENSMUSG00000058056

Gene Name

palladin, cytoskeletal associated protein

Synonyms

2410003B16Rik

MMRRC Submission

042922-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5343 (G1)

Quality Score

110

Status

Not validated

Chromosome

Chromosomal Location

61511433-61902690 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 61549815 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121200] [ENSMUST00000121493] [ENSMUST00000121785] [ENSMUST00000135439]

AlphaFold

Q9ET54

Predicted Effect

probably benign
Transcript: ENSMUST00000034057

SMART Domains

Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	667	N/A	INTRINSIC
IGc2	796	865	3.1e-9	SMART
low complexity region	881	906	N/A	INTRINSIC
IGc2	930	998	4.92e-12	SMART
IGc2	1029	1098	1.61e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000121200
AA Change: S78P

SMART Domains

Protein: ENSMUSP00000112374
Gene: ENSMUSG00000058056
AA Change: S78P

Domain	Start	End	E-Value	Type
low complexity region	37	68	N/A	INTRINSIC
low complexity region	77	112	N/A	INTRINSIC
IGc2	293	362	3.1e-9	SMART
low complexity region	378	403	N/A	INTRINSIC
IGc2	427	495	4.92e-12	SMART
IGc2	526	595	1.61e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000121493
AA Change: S417P

SMART Domains

Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056
AA Change: S417P

Domain	Start	End	E-Value	Type
IGc2	71	146	1.6e-11	SMART
low complexity region	250	284	N/A	INTRINSIC
low complexity region	298	326	N/A	INTRINSIC
low complexity region	376	407	N/A	INTRINSIC
low complexity region	416	451	N/A	INTRINSIC
IGc2	632	701	3.1e-9	SMART
low complexity region	717	742	N/A	INTRINSIC
IGc2	766	834	4.92e-12	SMART
IGc2	865	934	1.61e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000121785
AA Change: S806P

SMART Domains

Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: S806P

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	673	N/A	INTRINSIC
low complexity region	687	715	N/A	INTRINSIC
low complexity region	765	796	N/A	INTRINSIC
low complexity region	805	840	N/A	INTRINSIC
IGc2	1038	1107	3.1e-9	SMART
low complexity region	1123	1148	N/A	INTRINSIC
IGc2	1172	1240	4.92e-12	SMART
IGc2	1271	1340	1.61e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135439

SMART Domains

Protein: ENSMUSP00000119792
Gene: ENSMUSG00000058056

Domain	Start	End	E-Value	Type
IGc2	82	151	3.1e-9	SMART
low complexity region	167	192	N/A	INTRINSIC
IGc2	216	284	4.92e-12	SMART
internal_repeat_1	302	336	1.47e-9	PROSPERO

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310039H08Rik	C	A	17: 46,773,036	A75E	probably damaging	Het
5730559C18Rik	G	T	1: 136,225,442	H237Q	probably benign	Het
Adck5	G	A	15: 76,595,580	R560H	probably damaging	Het
Ahctf1	A	T	1: 179,770,634	Y964*	probably null	Het
Alg8	T	C	7: 97,386,919	I339T	possibly damaging	Het
Alox5	T	C	6: 116,413,507	D503G	possibly damaging	Het
Camk4	A	G	18: 33,078,069	T76A	probably damaging	Het
Cdh3	T	C	8: 106,552,936	V728A	probably benign	Het
Chd4	T	A	6: 125,120,363	N1326K	probably damaging	Het
Cnn1	A	T	9: 22,105,410	Y48F	probably benign	Het
Dnah6	T	A	6: 73,212,616	E16D	probably benign	Het
Ezh2	A	G	6: 47,576,615	L56S	probably damaging	Het
F13b	T	C	1: 139,510,544	V299A	possibly damaging	Het
Hydin	T	C	8: 110,485,419	S1279P	probably benign	Het
Ift172	T	C	5: 31,263,812	M981V	probably benign	Het
Lpl	T	A	8: 68,895,737	V206E	probably damaging	Het
Mre11a	A	G	9: 14,811,834	D368G	probably damaging	Het
Mreg	G	A	1: 72,160,958	P191L	probably damaging	Het
Mtif2	G	T	11: 29,536,964	A134S	probably damaging	Het
Mxd4	T	C	5: 34,177,730	S114G	probably benign	Het
Myo1b	T	C	1: 51,778,537	Q522R	probably benign	Het
Ncapd3	GGCTGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTGCTG	9: 27,088,053		probably benign	Het
Ninl	T	C	2: 150,971,190	E182G	probably benign	Het
Notch3	T	C	17: 32,143,283	N1456S	probably benign	Het
Npr1	G	T	3: 90,458,208	N648K	possibly damaging	Het
Oas3	A	G	5: 120,756,238	S1016P	possibly damaging	Het
Olfr1499	T	C	19: 13,814,960	N210S	probably damaging	Het
Olfr518	C	T	7: 108,880,998	V203M	possibly damaging	Het
Patj	T	G	4: 98,676,193	I1021S	probably damaging	Het
Pfpl	T	A	19: 12,428,688	L101Q	probably damaging	Het
Pilrb2	T	A	5: 137,870,966	E124V	possibly damaging	Het
Pomk	A	G	8: 25,983,016	F303S	probably benign	Het
Rap1gap2	A	T	11: 74,441,785	S65T	probably damaging	Het
Sema3a	G	A	5: 13,473,406	C114Y	probably damaging	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Spry4	A	T	18: 38,589,975	V245E	probably damaging	Het
Srrt	T	C	5: 137,297,165	Y271C	probably damaging	Het
Tas2r136	A	G	6: 132,778,080	V28A	probably benign	Het
Tenm2	A	G	11: 36,069,503	V998A	probably benign	Het
Trim37	A	G	11: 87,137,603	E46G	probably damaging	Het
Ubiad1	A	G	4: 148,436,435	V244A	possibly damaging	Het

Other mutations in Palld

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00917:Palld	APN	8	61515935	missense	possibly damaging	0.77
IGL01083:Palld	APN	8	61538807	missense	probably benign	0.44
IGL01644:Palld	APN	8	61877478	missense	probably benign	0.28
IGL01672:Palld	APN	8	61877502	missense	probably benign	0.22
IGL01941:Palld	APN	8	61535700	missense	probably benign	0.44
IGL02037:Palld	APN	8	61525114	missense	probably damaging	1.00
IGL02126:Palld	APN	8	61877442	missense	possibly damaging	0.82
IGL02537:Palld	APN	8	61684934	missense	probably benign	0.05
IGL02632:Palld	APN	8	61515245	missense	probably damaging	1.00
IGL02809:Palld	APN	8	61515247	missense	probably damaging	1.00
IGL02901:Palld	APN	8	61876995	nonsense	probably null
IGL03400:Palld	APN	8	61513455	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0745:Palld	UTSW	8	61877703	missense	probably damaging	1.00
R1263:Palld	UTSW	8	61513457	frame shift	probably null
R1342:Palld	UTSW	8	61522882	critical splice donor site	probably null
R1893:Palld	UTSW	8	61516621	missense	probably damaging	1.00
R2017:Palld	UTSW	8	61684765	missense	probably damaging	0.99
R2102:Palld	UTSW	8	61533433	missense	possibly damaging	0.82
R2129:Palld	UTSW	8	61877361	missense	probably benign	0.00
R2246:Palld	UTSW	8	61877135	missense	probably benign	0.01
R3545:Palld	UTSW	8	61550078	missense	possibly damaging	0.95
R3815:Palld	UTSW	8	61549837	intron	probably benign
R3824:Palld	UTSW	8	61709033	missense	probably damaging	1.00
R4412:Palld	UTSW	8	61687372	missense	probably damaging	0.98
R4781:Palld	UTSW	8	61877028	missense	probably benign	0.01
R4836:Palld	UTSW	8	61687381	missense	probably benign	0.11
R4871:Palld	UTSW	8	61549781	intron	probably benign
R4963:Palld	UTSW	8	61703210	missense	probably damaging	1.00
R5036:Palld	UTSW	8	61550162	missense	probably damaging	1.00
R5128:Palld	UTSW	8	61720588	missense	probably damaging	1.00
R5421:Palld	UTSW	8	61516550	missense	probably damaging	1.00
R5427:Palld	UTSW	8	61550072	missense	probably benign	0.01
R5561:Palld	UTSW	8	61516585	missense	probably damaging	1.00
R5651:Palld	UTSW	8	61538788	missense	probably damaging	1.00
R5679:Palld	UTSW	8	61684945	missense	possibly damaging	0.95
R5915:Palld	UTSW	8	61533352	critical splice donor site	probably null
R6153:Palld	UTSW	8	61550152	missense	probably damaging	1.00
R6276:Palld	UTSW	8	61513423	missense	probably damaging	1.00
R6323:Palld	UTSW	8	61720693	missense	probably damaging	1.00
R6659:Palld	UTSW	8	61533443	missense	probably benign	0.28
R7016:Palld	UTSW	8	61515998	missense	probably damaging	1.00
R7124:Palld	UTSW	8	61516645	missense	unknown
R7145:Palld	UTSW	8	61532017	missense	unknown
R7386:Palld	UTSW	8	61532052	missense	unknown
R7407:Palld	UTSW	8	61515941	nonsense	probably null
R7723:Palld	UTSW	8	61711458	missense	probably damaging	1.00
R8029:Palld	UTSW	8	61877312	missense	probably damaging	1.00
R8402:Palld	UTSW	8	61711406	missense	probably damaging	1.00
R8775:Palld	UTSW	8	61684972	missense	possibly damaging	0.73
R8775-TAIL:Palld	UTSW	8	61684972	missense	possibly damaging	0.73
R8887:Palld	UTSW	8	61533478	missense	unknown
R8906:Palld	UTSW	8	61550164	critical splice donor site	probably null
R8969:Palld	UTSW	8	61684849	missense	probably damaging	1.00
R8971:Palld	UTSW	8	61516701	missense	unknown
R8990:Palld	UTSW	8	61515245	missense	probably damaging	1.00
R9012:Palld	UTSW	8	61720663	missense	possibly damaging	0.85
R9145:Palld	UTSW	8	61877073	missense	probably benign	0.01
R9221:Palld	UTSW	8	61516557	missense	unknown
R9228:Palld	UTSW	8	61720537	missense	probably damaging	1.00
R9311:Palld	UTSW	8	61525155	missense	unknown
R9355:Palld	UTSW	8	61516657	missense	unknown
R9376:Palld	UTSW	8	61516657	missense	unknown
R9377:Palld	UTSW	8	61516657	missense	unknown
R9378:Palld	UTSW	8	61516657	missense	unknown
R9467:Palld	UTSW	8	61515230	missense	unknown
R9638:Palld	UTSW	8	61549754	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CGGAGATGCTAAGTGTCACTC -3'
(R):5'- AGCAGCTGCAGAACCAAGTG -3'

Sequencing Primer
(F):5'- AGGGCGTTGACAGCGAC -3'
(R):5'- TGTCCCTTGCAACAGCAG -3'

Posted On

2016-08-04