Incidental Mutation 'R5344:Tada1'
ID422467
Institutional Source Beutler Lab
Gene Symbol Tada1
Ensembl Gene ENSMUSG00000026563
Gene Nametranscriptional adaptor 1
Synonyms2900026B15Rik, Tada1l
MMRRC Submission 042923-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5344 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location166379097-166393621 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 166379512 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027846] [ENSMUST00000132817]
Predicted Effect probably benign
Transcript: ENSMUST00000027846
SMART Domains Protein: ENSMUSP00000027846
Gene: ENSMUSG00000026563

DomainStartEndE-ValueType
Pfam:SAGA-Tad1 6 131 3.2e-18 PFAM
Pfam:SAGA-Tad1 116 194 4.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195518
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TADA1L is a protein subunit of the human STAGA complex (SPT3; (MIM 602947)/TAF9 (MIM 600822)/GCN5 (MIM 602301) acetyltransferase complex), which is a chromatin-modifying multiprotein complex (Martinez et al., 2001 [PubMed 11564863]).[supplied by OMIM, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,243,027 C1499G probably benign Het
Aldoart1 A G 4: 72,852,115 V152A possibly damaging Het
Alms1 T C 6: 85,696,789 L3591P probably benign Het
Ankrd12 A T 17: 66,049,848 M58K probably damaging Het
Asb3 A C 11: 31,101,114 I523L probably benign Het
Ascl2 T C 7: 142,968,699 H4R possibly damaging Het
Asic2 T C 11: 80,971,587 M246V probably damaging Het
Btc A T 5: 91,376,920 C53S possibly damaging Het
Cdhr5 T C 7: 141,276,524 I39M probably damaging Het
Cdkn3 T A 14: 46,767,350 M123K possibly damaging Het
Cebpz A G 17: 78,926,113 Y762H possibly damaging Het
Ces1g T A 8: 93,337,193 probably benign Het
Cfap44 T C 16: 44,416,400 probably null Het
Chd7 G T 4: 8,844,417 G1537W probably damaging Het
Clca2 A T 3: 145,087,942 D317E probably damaging Het
Clec3a C A 8: 114,422,972 N56K probably damaging Het
Col11a1 T A 3: 114,208,362 probably null Het
Cox20 G A 1: 178,322,033 probably benign Het
Cyp2d22 A G 15: 82,371,638 V471A possibly damaging Het
D630045J12Rik A G 6: 38,158,228 V1339A probably damaging Het
Duox2 T C 2: 122,281,871 D1278G probably benign Het
Epc1 G A 18: 6,450,614 P284L probably benign Het
Evi5l G T 8: 4,185,990 R61L possibly damaging Het
Fbln2 T C 6: 91,266,383 Y914H probably damaging Het
Fbxo44 A G 4: 148,153,573 S191P probably damaging Het
Fign A G 2: 63,979,225 I567T probably benign Het
Fryl C T 5: 73,104,774 R550K probably damaging Het
Gpcpd1 G A 2: 132,558,677 probably benign Het
Hectd4 T C 5: 121,343,676 I3096T probably benign Het
Hic2 T A 16: 17,257,848 D180E probably benign Het
Ibtk A G 9: 85,735,004 F172L possibly damaging Het
Itga1 A G 13: 115,002,309 S369P possibly damaging Het
Itgb4 G A 11: 115,989,749 R675Q probably null Het
Lrrc3b T C 14: 15,358,591 D5G probably damaging Het
Maml3 T A 3: 52,103,725 D140V probably damaging Het
Med21 A G 6: 146,649,185 T65A probably benign Het
Mta1 T C 12: 113,131,566 probably benign Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Oas1b C A 5: 120,822,204 Q325K probably benign Het
Olfr1174-ps A C 2: 88,310,990 C269G probably benign Het
Olfr135 C A 17: 38,209,104 N286K probably damaging Het
Olfr1408 A G 1: 173,131,106 L37P probably benign Het
Pclo A G 5: 14,676,612 probably benign Het
Phactr2 C T 10: 13,253,616 V233I possibly damaging Het
Plekha2 A T 8: 25,043,047 probably null Het
Reg3b A G 6: 78,372,860 M128V probably benign Het
Rnaseh2a A G 8: 84,958,106 probably benign Het
Scn5a T C 9: 119,534,007 S516G probably benign Het
Serpina12 T A 12: 104,035,548 probably null Het
Slc10a1 T C 12: 80,953,766 T320A possibly damaging Het
Slc26a7 A T 4: 14,519,402 D539E probably benign Het
Specc1l C A 10: 75,246,173 R485S possibly damaging Het
Srp54b T G 12: 55,255,581 I339S probably damaging Het
Trim16 T C 11: 62,820,925 C54R probably damaging Het
Trio C T 15: 27,735,532 R2824Q probably benign Het
Ttpa A G 4: 20,021,245 I138V probably damaging Het
Ubap2 A C 4: 41,251,578 M18R possibly damaging Het
Usp38 A G 8: 80,985,763 S548P possibly damaging Het
Vmn2r73 T C 7: 85,875,838 D34G probably benign Het
Vps13d T A 4: 145,178,334 H74L probably damaging Het
Zfp408 C T 2: 91,645,243 C622Y probably benign Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Zfp9 C A 6: 118,465,179 C174F probably damaging Het
Zfyve16 A G 13: 92,521,588 I605T possibly damaging Het
Zmym5 T C 14: 56,794,062 T530A probably damaging Het
Other mutations in Tada1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Tada1 APN 1 166388725 missense probably damaging 1.00
IGL02458:Tada1 APN 1 166392634 missense probably damaging 0.99
R0959:Tada1 UTSW 1 166388629 missense probably benign 0.13
R1442:Tada1 UTSW 1 166386750 missense possibly damaging 0.90
R1586:Tada1 UTSW 1 166386750 missense possibly damaging 0.90
R4790:Tada1 UTSW 1 166391954 missense possibly damaging 0.87
R6782:Tada1 UTSW 1 166389972 missense probably benign 0.25
R7254:Tada1 UTSW 1 166388648 nonsense probably null
R7679:Tada1 UTSW 1 166391971 missense probably benign
R7733:Tada1 UTSW 1 166389942 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTTTCCCAACTGCGAGAC -3'
(R):5'- TGACCGACCGACTTCACTTG -3'

Sequencing Primer
(F):5'- AACGTCTCCCTAGCGGATG -3'
(R):5'- ACCGACTTCACTTGGGGTC -3'
Posted On2016-08-04