Incidental Mutation 'R5344:Clca2'
ID422477
Institutional Source Beutler Lab
Gene Symbol Clca2
Ensembl Gene ENSMUSG00000036960
Gene Namechloride channel accessory 2
SynonymsClca5
MMRRC Submission 042923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5344 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location145070263-145099443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145087942 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 317 (D317E)
Ref Sequence ENSEMBL: ENSMUSP00000143161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040465] [ENSMUST00000198993]
Predicted Effect probably damaging
Transcript: ENSMUST00000040465
AA Change: D317E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036029
Gene: ENSMUSG00000036960
AA Change: D317E

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
VWA 309 485 3.55e-5 SMART
low complexity region 739 754 N/A INTRINSIC
Blast:FN3 765 875 5e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000198993
AA Change: D317E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143161
Gene: ENSMUSG00000036960
AA Change: D317E

DomainStartEndE-ValueType
Pfam:CLCA_N 7 265 1.7e-121 PFAM
VWA 309 485 2.2e-7 SMART
Pfam:DUF1973 494 674 7.8e-75 PFAM
Meta Mutation Damage Score 0.4672 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a member of the calcium-activated chloride channel regulator (CLCR) family of proteins. Members of this family regulate the transport of chloride across the plasma membrane. Expression of this gene is upregulated by the tumor suppressor protein p53 in response to DNA damage. Mice lacking a functional copy of this gene exhibit increased liver weight and hepatocyte hypertrophy. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit increases in liver weight to body weight ratio and hepatocyte hypertrophy; one incidence of multifocal hepatic necrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,243,027 C1499G probably benign Het
Aldoart1 A G 4: 72,852,115 V152A possibly damaging Het
Alms1 T C 6: 85,696,789 L3591P probably benign Het
Ankrd12 A T 17: 66,049,848 M58K probably damaging Het
Asb3 A C 11: 31,101,114 I523L probably benign Het
Ascl2 T C 7: 142,968,699 H4R possibly damaging Het
Asic2 T C 11: 80,971,587 M246V probably damaging Het
Btc A T 5: 91,376,920 C53S possibly damaging Het
Cdhr5 T C 7: 141,276,524 I39M probably damaging Het
Cdkn3 T A 14: 46,767,350 M123K possibly damaging Het
Cebpz A G 17: 78,926,113 Y762H possibly damaging Het
Ces1g T A 8: 93,337,193 probably benign Het
Cfap44 T C 16: 44,416,400 probably null Het
Chd7 G T 4: 8,844,417 G1537W probably damaging Het
Clec3a C A 8: 114,422,972 N56K probably damaging Het
Col11a1 T A 3: 114,208,362 probably null Het
Cox20 G A 1: 178,322,033 probably benign Het
Cyp2d22 A G 15: 82,371,638 V471A possibly damaging Het
D630045J12Rik A G 6: 38,158,228 V1339A probably damaging Het
Duox2 T C 2: 122,281,871 D1278G probably benign Het
Epc1 G A 18: 6,450,614 P284L probably benign Het
Evi5l G T 8: 4,185,990 R61L possibly damaging Het
Fbln2 T C 6: 91,266,383 Y914H probably damaging Het
Fbxo44 A G 4: 148,153,573 S191P probably damaging Het
Fign A G 2: 63,979,225 I567T probably benign Het
Fryl C T 5: 73,104,774 R550K probably damaging Het
Gpcpd1 G A 2: 132,558,677 probably benign Het
Hectd4 T C 5: 121,343,676 I3096T probably benign Het
Hic2 T A 16: 17,257,848 D180E probably benign Het
Ibtk A G 9: 85,735,004 F172L possibly damaging Het
Itga1 A G 13: 115,002,309 S369P possibly damaging Het
Itgb4 G A 11: 115,989,749 R675Q probably null Het
Lrrc3b T C 14: 15,358,591 D5G probably damaging Het
Maml3 T A 3: 52,103,725 D140V probably damaging Het
Med21 A G 6: 146,649,185 T65A probably benign Het
Mta1 T C 12: 113,131,566 probably benign Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Oas1b C A 5: 120,822,204 Q325K probably benign Het
Olfr1174-ps A C 2: 88,310,990 C269G probably benign Het
Olfr135 C A 17: 38,209,104 N286K probably damaging Het
Olfr1408 A G 1: 173,131,106 L37P probably benign Het
Pclo A G 5: 14,676,612 probably benign Het
Phactr2 C T 10: 13,253,616 V233I possibly damaging Het
Plekha2 A T 8: 25,043,047 probably null Het
Reg3b A G 6: 78,372,860 M128V probably benign Het
Rnaseh2a A G 8: 84,958,106 probably benign Het
Scn5a T C 9: 119,534,007 S516G probably benign Het
Serpina12 T A 12: 104,035,548 probably null Het
Slc10a1 T C 12: 80,953,766 T320A possibly damaging Het
Slc26a7 A T 4: 14,519,402 D539E probably benign Het
Specc1l C A 10: 75,246,173 R485S possibly damaging Het
Srp54b T G 12: 55,255,581 I339S probably damaging Het
Tada1 G A 1: 166,379,512 probably benign Het
Trim16 T C 11: 62,820,925 C54R probably damaging Het
Trio C T 15: 27,735,532 R2824Q probably benign Het
Ttpa A G 4: 20,021,245 I138V probably damaging Het
Ubap2 A C 4: 41,251,578 M18R possibly damaging Het
Usp38 A G 8: 80,985,763 S548P possibly damaging Het
Vmn2r73 T C 7: 85,875,838 D34G probably benign Het
Vps13d T A 4: 145,178,334 H74L probably damaging Het
Zfp408 C T 2: 91,645,243 C622Y probably benign Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Zfp9 C A 6: 118,465,179 C174F probably damaging Het
Zfyve16 A G 13: 92,521,588 I605T possibly damaging Het
Zmym5 T C 14: 56,794,062 T530A probably damaging Het
Other mutations in Clca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Clca2 APN 3 145098813 missense probably damaging 1.00
IGL01337:Clca2 APN 3 145095178 missense probably damaging 1.00
IGL01389:Clca2 APN 3 145077868 critical splice donor site probably null
IGL01595:Clca2 APN 3 145088007 missense probably damaging 1.00
IGL01704:Clca2 APN 3 145095218 missense probably benign 0.04
IGL02416:Clca2 APN 3 145085016 missense probably benign 0.02
IGL02455:Clca2 APN 3 145081411 missense probably benign 0.00
IGL02481:Clca2 APN 3 145084940 missense possibly damaging 0.92
IGL02526:Clca2 APN 3 145088018 missense probably benign 0.02
IGL02797:Clca2 APN 3 145081263 missense probably benign 0.02
IGL03253:Clca2 APN 3 145071563 missense probably benign 0.41
IGL03256:Clca2 APN 3 145086392 missense possibly damaging 0.75
IGL03294:Clca2 APN 3 145097769 missense probably damaging 1.00
3370:Clca2 UTSW 3 145077977 missense probably damaging 1.00
R0479:Clca2 UTSW 3 145090849 missense probably damaging 1.00
R0542:Clca2 UTSW 3 145075810 splice site probably benign
R0629:Clca2 UTSW 3 145072239 missense probably benign
R1488:Clca2 UTSW 3 145084164 missense possibly damaging 0.49
R1523:Clca2 UTSW 3 145071644 nonsense probably null
R1568:Clca2 UTSW 3 145075649 nonsense probably null
R1650:Clca2 UTSW 3 145092212 missense probably damaging 1.00
R1771:Clca2 UTSW 3 145081410 missense probably benign 0.12
R2101:Clca2 UTSW 3 145077938 missense probably damaging 0.99
R2242:Clca2 UTSW 3 145090790 missense probably damaging 0.98
R3751:Clca2 UTSW 3 145071455 missense probably benign 0.04
R4496:Clca2 UTSW 3 145092165 missense possibly damaging 0.94
R4962:Clca2 UTSW 3 145077879 missense probably damaging 1.00
R5424:Clca2 UTSW 3 145084181 missense probably damaging 0.99
R5931:Clca2 UTSW 3 145092125 missense possibly damaging 0.88
R6181:Clca2 UTSW 3 145090708 nonsense probably null
R6598:Clca2 UTSW 3 145086485 nonsense probably null
R7167:Clca2 UTSW 3 145097784 missense probably benign 0.40
R7229:Clca2 UTSW 3 145084108 missense probably damaging 1.00
R7256:Clca2 UTSW 3 145090847 missense probably damaging 0.99
R7365:Clca2 UTSW 3 145098784 missense probably damaging 1.00
X0025:Clca2 UTSW 3 145086504 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGGTCTCCTGAGGTTTGTCC -3'
(R):5'- CAGGTGGTTGAATTCTGTAACG -3'

Sequencing Primer
(F):5'- AGGTTTGTCCTACCTCTTTCTCAAG -3'
(R):5'- GAAAGTACACACAACCAAGAAGCTC -3'
Posted On2016-08-04