Incidental Mutation 'R5344:Chd7'
ID422478
Institutional Source Beutler Lab
Gene Symbol Chd7
Ensembl Gene ENSMUSG00000041235
Gene Namechromodomain helicase DNA binding protein 7
SynonymsA730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi
MMRRC Submission 042923-MU
Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R5344 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location8690406-8867659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8844417 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 1537 (G1537W)
Ref Sequence ENSEMBL: ENSMUSP00000059079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]
Predicted Effect probably damaging
Transcript: ENSMUST00000039267
AA Change: G1537W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: G1537W

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051558
AA Change: G1537W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: G1537W

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130709
Predicted Effect probably benign
Transcript: ENSMUST00000170391
SMART Domains Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
BRK 586 630 3.77e-23 SMART
low complexity region 670 680 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 724 733 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 765 776 N/A INTRINSIC
low complexity region 852 871 N/A INTRINSIC
low complexity region 922 935 N/A INTRINSIC
Meta Mutation Damage Score 0.2049 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,243,027 C1499G probably benign Het
Aldoart1 A G 4: 72,852,115 V152A possibly damaging Het
Alms1 T C 6: 85,696,789 L3591P probably benign Het
Ankrd12 A T 17: 66,049,848 M58K probably damaging Het
Asb3 A C 11: 31,101,114 I523L probably benign Het
Ascl2 T C 7: 142,968,699 H4R possibly damaging Het
Asic2 T C 11: 80,971,587 M246V probably damaging Het
Btc A T 5: 91,376,920 C53S possibly damaging Het
Cdhr5 T C 7: 141,276,524 I39M probably damaging Het
Cdkn3 T A 14: 46,767,350 M123K possibly damaging Het
Cebpz A G 17: 78,926,113 Y762H possibly damaging Het
Ces1g T A 8: 93,337,193 probably benign Het
Cfap44 T C 16: 44,416,400 probably null Het
Clca2 A T 3: 145,087,942 D317E probably damaging Het
Clec3a C A 8: 114,422,972 N56K probably damaging Het
Col11a1 T A 3: 114,208,362 probably null Het
Cox20 G A 1: 178,322,033 probably benign Het
Cyp2d22 A G 15: 82,371,638 V471A possibly damaging Het
D630045J12Rik A G 6: 38,158,228 V1339A probably damaging Het
Duox2 T C 2: 122,281,871 D1278G probably benign Het
Epc1 G A 18: 6,450,614 P284L probably benign Het
Evi5l G T 8: 4,185,990 R61L possibly damaging Het
Fbln2 T C 6: 91,266,383 Y914H probably damaging Het
Fbxo44 A G 4: 148,153,573 S191P probably damaging Het
Fign A G 2: 63,979,225 I567T probably benign Het
Fryl C T 5: 73,104,774 R550K probably damaging Het
Gpcpd1 G A 2: 132,558,677 probably benign Het
Hectd4 T C 5: 121,343,676 I3096T probably benign Het
Hic2 T A 16: 17,257,848 D180E probably benign Het
Ibtk A G 9: 85,735,004 F172L possibly damaging Het
Itga1 A G 13: 115,002,309 S369P possibly damaging Het
Itgb4 G A 11: 115,989,749 R675Q probably null Het
Lrrc3b T C 14: 15,358,591 D5G probably damaging Het
Maml3 T A 3: 52,103,725 D140V probably damaging Het
Med21 A G 6: 146,649,185 T65A probably benign Het
Mta1 T C 12: 113,131,566 probably benign Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Oas1b C A 5: 120,822,204 Q325K probably benign Het
Olfr1174-ps A C 2: 88,310,990 C269G probably benign Het
Olfr135 C A 17: 38,209,104 N286K probably damaging Het
Olfr1408 A G 1: 173,131,106 L37P probably benign Het
Pclo A G 5: 14,676,612 probably benign Het
Phactr2 C T 10: 13,253,616 V233I possibly damaging Het
Plekha2 A T 8: 25,043,047 probably null Het
Reg3b A G 6: 78,372,860 M128V probably benign Het
Rnaseh2a A G 8: 84,958,106 probably benign Het
Scn5a T C 9: 119,534,007 S516G probably benign Het
Serpina12 T A 12: 104,035,548 probably null Het
Slc10a1 T C 12: 80,953,766 T320A possibly damaging Het
Slc26a7 A T 4: 14,519,402 D539E probably benign Het
Specc1l C A 10: 75,246,173 R485S possibly damaging Het
Srp54b T G 12: 55,255,581 I339S probably damaging Het
Tada1 G A 1: 166,379,512 probably benign Het
Trim16 T C 11: 62,820,925 C54R probably damaging Het
Trio C T 15: 27,735,532 R2824Q probably benign Het
Ttpa A G 4: 20,021,245 I138V probably damaging Het
Ubap2 A C 4: 41,251,578 M18R possibly damaging Het
Usp38 A G 8: 80,985,763 S548P possibly damaging Het
Vmn2r73 T C 7: 85,875,838 D34G probably benign Het
Vps13d T A 4: 145,178,334 H74L probably damaging Het
Zfp408 C T 2: 91,645,243 C622Y probably benign Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Zfp9 C A 6: 118,465,179 C174F probably damaging Het
Zfyve16 A G 13: 92,521,588 I605T possibly damaging Het
Zmym5 T C 14: 56,794,062 T530A probably damaging Het
Other mutations in Chd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Chd7 APN 4 8859106 missense probably damaging 1.00
IGL00510:Chd7 APN 4 8801404 missense probably damaging 1.00
IGL00741:Chd7 APN 4 8839454 missense probably damaging 1.00
IGL00796:Chd7 APN 4 8847271 missense possibly damaging 0.95
IGL00907:Chd7 APN 4 8840435 missense probably damaging 0.98
IGL00930:Chd7 APN 4 8805181 missense probably damaging 1.00
IGL01542:Chd7 APN 4 8859285 missense possibly damaging 0.71
IGL01602:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01605:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01670:Chd7 APN 4 8827033 missense probably damaging 0.98
IGL02434:Chd7 APN 4 8752145 missense probably benign 0.00
IGL02531:Chd7 APN 4 8854134 missense probably damaging 1.00
IGL02626:Chd7 APN 4 8826519 missense probably damaging 1.00
IGL02961:Chd7 APN 4 8751542 missense probably damaging 1.00
IGL02972:Chd7 APN 4 8855174 missense probably benign 0.30
IGL03329:Chd7 APN 4 8841108 missense probably damaging 1.00
Fili UTSW 4 8839523 missense probably damaging 1.00
D4043:Chd7 UTSW 4 8862650 missense probably damaging 1.00
IGL02991:Chd7 UTSW 4 8828398 missense possibly damaging 0.91
PIT4466001:Chd7 UTSW 4 8753101 missense unknown
PIT4472001:Chd7 UTSW 4 8753101 missense unknown
R0157:Chd7 UTSW 4 8833759 missense probably damaging 1.00
R0179:Chd7 UTSW 4 8862516 missense probably benign 0.22
R0240:Chd7 UTSW 4 8852670 unclassified probably benign
R0388:Chd7 UTSW 4 8854560 missense probably benign 0.27
R0462:Chd7 UTSW 4 8850821 missense probably damaging 1.00
R0512:Chd7 UTSW 4 8805139 intron probably benign
R0657:Chd7 UTSW 4 8753141 missense probably damaging 1.00
R0799:Chd7 UTSW 4 8801310 intron probably benign
R0885:Chd7 UTSW 4 8866432 missense probably damaging 1.00
R1056:Chd7 UTSW 4 8822402 missense possibly damaging 0.50
R1086:Chd7 UTSW 4 8866458 missense probably benign 0.04
R1353:Chd7 UTSW 4 8839556 missense probably damaging 0.99
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1605:Chd7 UTSW 4 8844675 missense probably damaging 1.00
R1693:Chd7 UTSW 4 8864307 critical splice donor site probably null
R1695:Chd7 UTSW 4 8833960 missense probably damaging 1.00
R1938:Chd7 UTSW 4 8847200 missense probably damaging 1.00
R1964:Chd7 UTSW 4 8865978 missense probably damaging 0.96
R2020:Chd7 UTSW 4 8855226 missense probably benign 0.00
R2134:Chd7 UTSW 4 8753147 missense probably damaging 0.99
R2171:Chd7 UTSW 4 8752424 missense probably damaging 1.00
R2271:Chd7 UTSW 4 8785532 missense probably damaging 1.00
R2300:Chd7 UTSW 4 8855241 missense probably benign 0.02
R2355:Chd7 UTSW 4 8801350 missense possibly damaging 0.95
R3153:Chd7 UTSW 4 8855174 missense probably benign 0.30
R3430:Chd7 UTSW 4 8844517 missense probably damaging 0.99
R3746:Chd7 UTSW 4 8752537 missense probably damaging 1.00
R4118:Chd7 UTSW 4 8865831 missense probably damaging 1.00
R4119:Chd7 UTSW 4 8785658 intron probably benign
R4332:Chd7 UTSW 4 8854143 missense probably damaging 1.00
R4402:Chd7 UTSW 4 8866353 missense possibly damaging 0.61
R4571:Chd7 UTSW 4 8866217 missense probably benign 0.09
R4722:Chd7 UTSW 4 8822445 missense probably damaging 1.00
R4821:Chd7 UTSW 4 8844706 missense probably damaging 1.00
R4894:Chd7 UTSW 4 8838629 missense probably damaging 0.99
R5205:Chd7 UTSW 4 8752509 missense possibly damaging 0.60
R5484:Chd7 UTSW 4 8828258 missense probably damaging 1.00
R5578:Chd7 UTSW 4 8847149 missense probably benign 0.09
R5583:Chd7 UTSW 4 8752473 missense probably damaging 1.00
R5888:Chd7 UTSW 4 8866382 missense probably damaging 0.98
R5905:Chd7 UTSW 4 8840553 missense possibly damaging 0.91
R6091:Chd7 UTSW 4 8751875 missense probably damaging 0.99
R6126:Chd7 UTSW 4 8826482 missense probably damaging 1.00
R6399:Chd7 UTSW 4 8828274 missense probably damaging 1.00
R6751:Chd7 UTSW 4 8833866 missense probably damaging 1.00
R6810:Chd7 UTSW 4 8839523 missense probably damaging 1.00
R6868:Chd7 UTSW 4 8811501 splice site probably null
R6952:Chd7 UTSW 4 8856797 missense probably damaging 1.00
R6986:Chd7 UTSW 4 8859285 missense possibly damaging 0.71
R6990:Chd7 UTSW 4 8844525 missense probably benign 0.28
R7139:Chd7 UTSW 4 8865865 missense probably benign 0.00
R7288:Chd7 UTSW 4 8847093 missense possibly damaging 0.92
R7355:Chd7 UTSW 4 8752196 missense unknown
R7452:Chd7 UTSW 4 8854731 missense probably benign 0.03
R7471:Chd7 UTSW 4 8859197 missense probably damaging 0.96
R7588:Chd7 UTSW 4 8864039 missense probably damaging 1.00
R7711:Chd7 UTSW 4 8805234 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAGCACGCATATACTGTGAC -3'
(R):5'- AGGCTTTTCTTCGGAGTCGC -3'

Sequencing Primer
(F):5'- CTGTGACTAGATAAACAGAGGCTACC -3'
(R):5'- CTTCGGAGTCGCTTTCCAGG -3'
Posted On2016-08-04