Incidental Mutation 'R5344:Plekha2'
ID422500
Institutional Source Beutler Lab
Gene Symbol Plekha2
Ensembl Gene ENSMUSG00000031557
Gene Namepleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2
Synonyms6430512N22Rik, TAPP2
MMRRC Submission 042923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5344 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25039144-25102376 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 25043047 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064883] [ENSMUST00000064883] [ENSMUST00000084031] [ENSMUST00000098866] [ENSMUST00000098866] [ENSMUST00000128715] [ENSMUST00000128715]
Predicted Effect probably null
Transcript: ENSMUST00000064883
SMART Domains Protein: ENSMUSP00000066546
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000064883
SMART Domains Protein: ENSMUSP00000066546
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084031
SMART Domains Protein: ENSMUSP00000081044
Gene: ENSMUSG00000037406

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IB 37 112 5.44e-7 SMART
KAZAL 109 158 7.92e-4 SMART
Pfam:Trypsin 182 368 5.5e-15 PFAM
Pfam:Trypsin_2 208 346 2.1e-34 PFAM
PDZ 385 470 5.34e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098866
SMART Domains Protein: ENSMUSP00000096464
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098866
SMART Domains Protein: ENSMUSP00000096464
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128715
SMART Domains Protein: ENSMUSP00000122564
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128715
SMART Domains Protein: ENSMUSP00000122564
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211059
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,243,027 C1499G probably benign Het
Aldoart1 A G 4: 72,852,115 V152A possibly damaging Het
Alms1 T C 6: 85,696,789 L3591P probably benign Het
Ankrd12 A T 17: 66,049,848 M58K probably damaging Het
Asb3 A C 11: 31,101,114 I523L probably benign Het
Ascl2 T C 7: 142,968,699 H4R possibly damaging Het
Asic2 T C 11: 80,971,587 M246V probably damaging Het
Btc A T 5: 91,376,920 C53S possibly damaging Het
Cdhr5 T C 7: 141,276,524 I39M probably damaging Het
Cdkn3 T A 14: 46,767,350 M123K possibly damaging Het
Cebpz A G 17: 78,926,113 Y762H possibly damaging Het
Ces1g T A 8: 93,337,193 probably benign Het
Cfap44 T C 16: 44,416,400 probably null Het
Chd7 G T 4: 8,844,417 G1537W probably damaging Het
Clca2 A T 3: 145,087,942 D317E probably damaging Het
Clec3a C A 8: 114,422,972 N56K probably damaging Het
Col11a1 T A 3: 114,208,362 probably null Het
Cox20 G A 1: 178,322,033 probably benign Het
Cyp2d22 A G 15: 82,371,638 V471A possibly damaging Het
D630045J12Rik A G 6: 38,158,228 V1339A probably damaging Het
Duox2 T C 2: 122,281,871 D1278G probably benign Het
Epc1 G A 18: 6,450,614 P284L probably benign Het
Evi5l G T 8: 4,185,990 R61L possibly damaging Het
Fbln2 T C 6: 91,266,383 Y914H probably damaging Het
Fbxo44 A G 4: 148,153,573 S191P probably damaging Het
Fign A G 2: 63,979,225 I567T probably benign Het
Fryl C T 5: 73,104,774 R550K probably damaging Het
Gpcpd1 G A 2: 132,558,677 probably benign Het
Hectd4 T C 5: 121,343,676 I3096T probably benign Het
Hic2 T A 16: 17,257,848 D180E probably benign Het
Ibtk A G 9: 85,735,004 F172L possibly damaging Het
Itga1 A G 13: 115,002,309 S369P possibly damaging Het
Itgb4 G A 11: 115,989,749 R675Q probably null Het
Lrrc3b T C 14: 15,358,591 D5G probably damaging Het
Maml3 T A 3: 52,103,725 D140V probably damaging Het
Med21 A G 6: 146,649,185 T65A probably benign Het
Mta1 T C 12: 113,131,566 probably benign Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Oas1b C A 5: 120,822,204 Q325K probably benign Het
Olfr1174-ps A C 2: 88,310,990 C269G probably benign Het
Olfr135 C A 17: 38,209,104 N286K probably damaging Het
Olfr1408 A G 1: 173,131,106 L37P probably benign Het
Pclo A G 5: 14,676,612 probably benign Het
Phactr2 C T 10: 13,253,616 V233I possibly damaging Het
Reg3b A G 6: 78,372,860 M128V probably benign Het
Rnaseh2a A G 8: 84,958,106 probably benign Het
Scn5a T C 9: 119,534,007 S516G probably benign Het
Serpina12 T A 12: 104,035,548 probably null Het
Slc10a1 T C 12: 80,953,766 T320A possibly damaging Het
Slc26a7 A T 4: 14,519,402 D539E probably benign Het
Specc1l C A 10: 75,246,173 R485S possibly damaging Het
Srp54b T G 12: 55,255,581 I339S probably damaging Het
Tada1 G A 1: 166,379,512 probably benign Het
Trim16 T C 11: 62,820,925 C54R probably damaging Het
Trio C T 15: 27,735,532 R2824Q probably benign Het
Ttpa A G 4: 20,021,245 I138V probably damaging Het
Ubap2 A C 4: 41,251,578 M18R possibly damaging Het
Usp38 A G 8: 80,985,763 S548P possibly damaging Het
Vmn2r73 T C 7: 85,875,838 D34G probably benign Het
Vps13d T A 4: 145,178,334 H74L probably damaging Het
Zfp408 C T 2: 91,645,243 C622Y probably benign Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Zfp9 C A 6: 118,465,179 C174F probably damaging Het
Zfyve16 A G 13: 92,521,588 I605T possibly damaging Het
Zmym5 T C 14: 56,794,062 T530A probably damaging Het
Other mutations in Plekha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Plekha2 APN 8 25057327 missense probably damaging 0.98
IGL02123:Plekha2 APN 8 25042729 missense probably damaging 1.00
Byzantine UTSW 8 25088395 missense probably damaging 1.00
Elaborate UTSW 8 25043047 splice site probably null
R1178:Plekha2 UTSW 8 25059202 missense probably benign 0.26
R1181:Plekha2 UTSW 8 25059202 missense probably benign 0.26
R1668:Plekha2 UTSW 8 25072054 missense probably damaging 0.98
R1722:Plekha2 UTSW 8 25042960 missense probably benign 0.02
R2153:Plekha2 UTSW 8 25088397 missense probably damaging 1.00
R4223:Plekha2 UTSW 8 25043020 missense probably damaging 1.00
R4585:Plekha2 UTSW 8 25043669 nonsense probably null
R4604:Plekha2 UTSW 8 25059835 missense probably null 1.00
R4791:Plekha2 UTSW 8 25042762 missense probably damaging 1.00
R4817:Plekha2 UTSW 8 25059944 missense possibly damaging 0.94
R5670:Plekha2 UTSW 8 25059238 missense probably benign 0.03
R5892:Plekha2 UTSW 8 25052365 missense probably benign
R6440:Plekha2 UTSW 8 25088397 missense probably damaging 1.00
R6970:Plekha2 UTSW 8 25059264 missense probably benign 0.00
R7157:Plekha2 UTSW 8 25063941 missense probably damaging 1.00
R7242:Plekha2 UTSW 8 25088395 missense probably damaging 1.00
R7674:Plekha2 UTSW 8 25057298 missense probably damaging 1.00
R7810:Plekha2 UTSW 8 25088340 critical splice donor site probably null
X0027:Plekha2 UTSW 8 25057303 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACAACGGCTTTTCCTCAGC -3'
(R):5'- CCTACAAGTCCAGCATCAGG -3'

Sequencing Primer
(F):5'- TTTTCCTCAGCCTGGGGGAC -3'
(R):5'- TGTGGTCCAGACTACTACTGCAAG -3'
Posted On2016-08-04