Mutagenetix > Incidental Mutations

Incidental Mutation 'R5344:Mta1'

422520

Institutional Source

Beutler Lab

Gene Symbol

Mta1

Ensembl Gene

ENSMUSG00000021144

Gene Name

metastasis associated 1

Synonyms

MMRRC Submission

042923-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5344 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113098278-113137206 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 113131566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727]

AlphaFold

Q8K4B0

Predicted Effect

probably benign
Transcript: ENSMUST00000009099

SMART Domains

Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	695	705	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000069690

SMART Domains

Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144

Domain	Start	End	E-Value	Type
BAH	4	147	2.7e-32	SMART
ELM2	150	204	2.36e-13	SMART
SANT	267	316	2.62e-8	SMART
ZnF_GATA	370	424	2.6e-16	SMART
low complexity region	528	548	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109723

SMART Domains

Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	683	693	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109726

SMART Domains

Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144

Domain	Start	End	E-Value	Type
BAH	4	147	2.7e-32	SMART
ELM2	150	204	2.36e-13	SMART
SANT	267	316	2.62e-8	SMART
ZnF_GATA	370	424	2.6e-16	SMART
low complexity region	528	548	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109727

SMART Domains

Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	683	693	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130926

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134488

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156030

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	G	12: 71,243,027	C1499G	probably benign	Het
Aldoart1	A	G	4: 72,852,115	V152A	possibly damaging	Het
Alms1	T	C	6: 85,696,789	L3591P	probably benign	Het
Ankrd12	A	T	17: 66,049,848	M58K	probably damaging	Het
Asb3	A	C	11: 31,101,114	I523L	probably benign	Het
Ascl2	T	C	7: 142,968,699	H4R	possibly damaging	Het
Asic2	T	C	11: 80,971,587	M246V	probably damaging	Het
Btc	A	T	5: 91,376,920	C53S	possibly damaging	Het
Cdhr5	T	C	7: 141,276,524	I39M	probably damaging	Het
Cdkn3	T	A	14: 46,767,350	M123K	possibly damaging	Het
Cebpz	A	G	17: 78,926,113	Y762H	possibly damaging	Het
Ces1g	T	A	8: 93,337,193		probably benign	Het
Cfap44	T	C	16: 44,416,400		probably null	Het
Chd7	G	T	4: 8,844,417	G1537W	probably damaging	Het
Clca2	A	T	3: 145,087,942	D317E	probably damaging	Het
Clec3a	C	A	8: 114,422,972	N56K	probably damaging	Het
Col11a1	T	A	3: 114,208,362		probably null	Het
Cox20	G	A	1: 178,322,033		probably benign	Het
Cyp2d22	A	G	15: 82,371,638	V471A	possibly damaging	Het
D630045J12Rik	A	G	6: 38,158,228	V1339A	probably damaging	Het
Duox2	T	C	2: 122,281,871	D1278G	probably benign	Het
Epc1	G	A	18: 6,450,614	P284L	probably benign	Het
Evi5l	G	T	8: 4,185,990	R61L	possibly damaging	Het
Fbln2	T	C	6: 91,266,383	Y914H	probably damaging	Het
Fbxo44	A	G	4: 148,153,573	S191P	probably damaging	Het
Fign	A	G	2: 63,979,225	I567T	probably benign	Het
Fryl	C	T	5: 73,104,774	R550K	probably damaging	Het
Gpcpd1	G	A	2: 132,558,677		probably benign	Het
Hectd4	T	C	5: 121,343,676	I3096T	probably benign	Het
Hic2	T	A	16: 17,257,848	D180E	probably benign	Het
Ibtk	A	G	9: 85,735,004	F172L	possibly damaging	Het
Itga1	A	G	13: 115,002,309	S369P	possibly damaging	Het
Itgb4	G	A	11: 115,989,749	R675Q	probably null	Het
Lrrc3b	T	C	14: 15,358,591	D5G	probably damaging	Het
Maml3	T	A	3: 52,103,725	D140V	probably damaging	Het
Med21	A	G	6: 146,649,185	T65A	probably benign	Het
Mybpc1	T	C	10: 88,570,568	D152G	probably damaging	Het
Oas1b	C	A	5: 120,822,204	Q325K	probably benign	Het
Olfr1174-ps	A	C	2: 88,310,990	C269G	probably benign	Het
Olfr135	C	A	17: 38,209,104	N286K	probably damaging	Het
Olfr1408	A	G	1: 173,131,106	L37P	probably benign	Het
Pclo	A	G	5: 14,676,612		probably benign	Het
Phactr2	C	T	10: 13,253,616	V233I	possibly damaging	Het
Plekha2	A	T	8: 25,043,047		probably null	Het
Reg3b	A	G	6: 78,372,860	M128V	probably benign	Het
Rnaseh2a	A	G	8: 84,958,106		probably benign	Het
Scn5a	T	C	9: 119,534,007	S516G	probably benign	Het
Serpina12	T	A	12: 104,035,548		probably null	Het
Slc10a1	T	C	12: 80,953,766	T320A	possibly damaging	Het
Slc26a7	A	T	4: 14,519,402	D539E	probably benign	Het
Specc1l	C	A	10: 75,246,173	R485S	possibly damaging	Het
Srp54b	T	G	12: 55,255,581	I339S	probably damaging	Het
Tada1	G	A	1: 166,379,512		probably benign	Het
Trim16	T	C	11: 62,820,925	C54R	probably damaging	Het
Trio	C	T	15: 27,735,532	R2824Q	probably benign	Het
Ttpa	A	G	4: 20,021,245	I138V	probably damaging	Het
Ubap2	A	C	4: 41,251,578	M18R	possibly damaging	Het
Usp38	A	G	8: 80,985,763	S548P	possibly damaging	Het
Vmn2r73	T	C	7: 85,875,838	D34G	probably benign	Het
Vps13d	T	A	4: 145,178,334	H74L	probably damaging	Het
Zfp408	C	T	2: 91,645,243	C622Y	probably benign	Het
Zfp616	T	C	11: 74,084,495	I530T	possibly damaging	Het
Zfp9	C	A	6: 118,465,179	C174F	probably damaging	Het
Zfyve16	A	G	13: 92,521,588	I605T	possibly damaging	Het
Zmym5	T	C	14: 56,794,062	T530A	probably damaging	Het

Other mutations in Mta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02227:Mta1	APN	12	113120908	missense	possibly damaging	0.94
IGL02250:Mta1	APN	12	113126798	missense	possibly damaging	0.59
IGL02391:Mta1	APN	12	113136583	missense	possibly damaging	0.79
IGL02670:Mta1	APN	12	113130121	missense	probably damaging	1.00
PIT4382001:Mta1	UTSW	12	113133250	missense	probably benign	0.06
R0361:Mta1	UTSW	12	113133341	splice site	probably null
R0496:Mta1	UTSW	12	113131321	nonsense	probably null
R1774:Mta1	UTSW	12	113128039	missense	probably damaging	1.00
R1870:Mta1	UTSW	12	113128074	missense	possibly damaging	0.73
R1976:Mta1	UTSW	12	113136306	missense	probably damaging	0.97
R2110:Mta1	UTSW	12	113131628	missense	probably damaging	1.00
R2111:Mta1	UTSW	12	113131628	missense	probably damaging	1.00
R2184:Mta1	UTSW	12	113130195	critical splice donor site	probably null
R2274:Mta1	UTSW	12	113128150	missense	probably damaging	1.00
R4087:Mta1	UTSW	12	113112182	missense	probably damaging	1.00
R4231:Mta1	UTSW	12	113135827	missense	possibly damaging	0.95
R4916:Mta1	UTSW	12	113136540	missense	probably benign	0.17
R5032:Mta1	UTSW	12	113133525	splice site	probably null
R5271:Mta1	UTSW	12	113131957	missense	probably damaging	0.99
R5392:Mta1	UTSW	12	113133236	missense	probably benign
R5656:Mta1	UTSW	12	113123139	missense	probably damaging	1.00
R5903:Mta1	UTSW	12	113136619	missense	probably damaging	1.00
R6168:Mta1	UTSW	12	113123119	missense	probably damaging	0.96
R7091:Mta1	UTSW	12	113136402	missense	probably damaging	1.00
R7334:Mta1	UTSW	12	113126798	missense	possibly damaging	0.59
R7408:Mta1	UTSW	12	113131468	critical splice donor site	probably null
R7889:Mta1	UTSW	12	113131688	missense	probably benign	0.02
R8136:Mta1	UTSW	12	113131678	missense	probably damaging	1.00
R8176:Mta1	UTSW	12	113120836	missense	probably benign	0.00
R8385:Mta1	UTSW	12	113131465	missense	probably benign
R8398:Mta1	UTSW	12	113131622	missense	possibly damaging	0.83
R9132:Mta1	UTSW	12	113136405	missense	probably damaging	1.00
R9159:Mta1	UTSW	12	113136405	missense	probably damaging	1.00
R9418:Mta1	UTSW	12	113131367	missense	probably damaging	1.00
Z1088:Mta1	UTSW	12	113133200	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- GCGCATCTTGTTGGACATATTG -3'
(R):5'- GGGGAAGACTCACATTCAGC -3'

Sequencing Primer
(F):5'- CATATTGGAAGAAATATGGTGGCTTG -3'
(R):5'- GGAAGACTCACATTCAGCCTTGATTG -3'

Posted On

2016-08-04