Incidental Mutation 'R5344:Itga1'
ID422522
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Nameintegrin alpha 1
SynonymsCD49A, Vla1, E130012M19Rik
MMRRC Submission 042923-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R5344 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location114953096-115101964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115002309 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 369 (S369P)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061673
AA Change: S369P

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: S369P

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224865
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,243,027 C1499G probably benign Het
Aldoart1 A G 4: 72,852,115 V152A possibly damaging Het
Alms1 T C 6: 85,696,789 L3591P probably benign Het
Ankrd12 A T 17: 66,049,848 M58K probably damaging Het
Asb3 A C 11: 31,101,114 I523L probably benign Het
Ascl2 T C 7: 142,968,699 H4R possibly damaging Het
Asic2 T C 11: 80,971,587 M246V probably damaging Het
Btc A T 5: 91,376,920 C53S possibly damaging Het
Cdhr5 T C 7: 141,276,524 I39M probably damaging Het
Cdkn3 T A 14: 46,767,350 M123K possibly damaging Het
Cebpz A G 17: 78,926,113 Y762H possibly damaging Het
Ces1g T A 8: 93,337,193 probably benign Het
Cfap44 T C 16: 44,416,400 probably null Het
Chd7 G T 4: 8,844,417 G1537W probably damaging Het
Clca2 A T 3: 145,087,942 D317E probably damaging Het
Clec3a C A 8: 114,422,972 N56K probably damaging Het
Col11a1 T A 3: 114,208,362 probably null Het
Cox20 G A 1: 178,322,033 probably benign Het
Cyp2d22 A G 15: 82,371,638 V471A possibly damaging Het
D630045J12Rik A G 6: 38,158,228 V1339A probably damaging Het
Duox2 T C 2: 122,281,871 D1278G probably benign Het
Epc1 G A 18: 6,450,614 P284L probably benign Het
Evi5l G T 8: 4,185,990 R61L possibly damaging Het
Fbln2 T C 6: 91,266,383 Y914H probably damaging Het
Fbxo44 A G 4: 148,153,573 S191P probably damaging Het
Fign A G 2: 63,979,225 I567T probably benign Het
Fryl C T 5: 73,104,774 R550K probably damaging Het
Gpcpd1 G A 2: 132,558,677 probably benign Het
Hectd4 T C 5: 121,343,676 I3096T probably benign Het
Hic2 T A 16: 17,257,848 D180E probably benign Het
Ibtk A G 9: 85,735,004 F172L possibly damaging Het
Itgb4 G A 11: 115,989,749 R675Q probably null Het
Lrrc3b T C 14: 15,358,591 D5G probably damaging Het
Maml3 T A 3: 52,103,725 D140V probably damaging Het
Med21 A G 6: 146,649,185 T65A probably benign Het
Mta1 T C 12: 113,131,566 probably benign Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Oas1b C A 5: 120,822,204 Q325K probably benign Het
Olfr1174-ps A C 2: 88,310,990 C269G probably benign Het
Olfr135 C A 17: 38,209,104 N286K probably damaging Het
Olfr1408 A G 1: 173,131,106 L37P probably benign Het
Pclo A G 5: 14,676,612 probably benign Het
Phactr2 C T 10: 13,253,616 V233I possibly damaging Het
Plekha2 A T 8: 25,043,047 probably null Het
Reg3b A G 6: 78,372,860 M128V probably benign Het
Rnaseh2a A G 8: 84,958,106 probably benign Het
Scn5a T C 9: 119,534,007 S516G probably benign Het
Serpina12 T A 12: 104,035,548 probably null Het
Slc10a1 T C 12: 80,953,766 T320A possibly damaging Het
Slc26a7 A T 4: 14,519,402 D539E probably benign Het
Specc1l C A 10: 75,246,173 R485S possibly damaging Het
Srp54b T G 12: 55,255,581 I339S probably damaging Het
Tada1 G A 1: 166,379,512 probably benign Het
Trim16 T C 11: 62,820,925 C54R probably damaging Het
Trio C T 15: 27,735,532 R2824Q probably benign Het
Ttpa A G 4: 20,021,245 I138V probably damaging Het
Ubap2 A C 4: 41,251,578 M18R possibly damaging Het
Usp38 A G 8: 80,985,763 S548P possibly damaging Het
Vmn2r73 T C 7: 85,875,838 D34G probably benign Het
Vps13d T A 4: 145,178,334 H74L probably damaging Het
Zfp408 C T 2: 91,645,243 C622Y probably benign Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Zfp9 C A 6: 118,465,179 C174F probably damaging Het
Zfyve16 A G 13: 92,521,588 I605T possibly damaging Het
Zmym5 T C 14: 56,794,062 T530A probably damaging Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 114992363 missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115031193 missense probably benign 0.00
IGL00549:Itga1 APN 13 115049296 missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115012249 missense probably damaging 1.00
IGL01021:Itga1 APN 13 114997000 missense probably benign 0.29
IGL01289:Itga1 APN 13 114986226 missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115006948 missense possibly damaging 0.73
IGL01791:Itga1 APN 13 114987661 missense probably benign 0.00
IGL01796:Itga1 APN 13 114985121 missense probably damaging 1.00
IGL02027:Itga1 APN 13 114990055 splice site probably null
IGL02330:Itga1 APN 13 115012204 missense probably damaging 1.00
IGL02480:Itga1 APN 13 114987648 missense probably damaging 1.00
IGL02943:Itga1 APN 13 115049296 missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0244:Itga1 UTSW 13 115006897 splice site probably benign
R0265:Itga1 UTSW 13 114992459 missense probably benign
R0302:Itga1 UTSW 13 115012318 splice site probably benign
R0320:Itga1 UTSW 13 114977594 splice site probably benign
R0389:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0443:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0574:Itga1 UTSW 13 114966561 missense probably damaging 1.00
R0646:Itga1 UTSW 13 114968299 missense probably benign
R0830:Itga1 UTSW 13 115007032 missense probably benign 0.08
R2162:Itga1 UTSW 13 115030910 missense probably benign 0.23
R2216:Itga1 UTSW 13 114997029 missense probably benign 0.00
R2403:Itga1 UTSW 13 114977614 missense probably benign 0.00
R3734:Itga1 UTSW 13 114977639 missense probably benign
R4171:Itga1 UTSW 13 115030886 nonsense probably null
R4402:Itga1 UTSW 13 115001566 missense probably benign 0.00
R4675:Itga1 UTSW 13 115001691 splice site probably null
R4684:Itga1 UTSW 13 115049370 missense probably damaging 1.00
R4795:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4796:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4845:Itga1 UTSW 13 114974172 nonsense probably null
R5147:Itga1 UTSW 13 114985142 missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115035303 missense probably benign
R5234:Itga1 UTSW 13 115049303 nonsense probably null
R5554:Itga1 UTSW 13 114992474 nonsense probably null
R5662:Itga1 UTSW 13 114986171 missense probably benign 0.03
R5945:Itga1 UTSW 13 114966590 missense probably benign 0.02
R6150:Itga1 UTSW 13 114968233 missense probably benign 0.01
R6241:Itga1 UTSW 13 114960137 splice site probably null
R6276:Itga1 UTSW 13 114980852 missense probably benign
R6369:Itga1 UTSW 13 114965660 missense probably damaging 1.00
R6511:Itga1 UTSW 13 114992501 missense probably damaging 0.98
R6663:Itga1 UTSW 13 114974105 missense probably benign 0.02
R6783:Itga1 UTSW 13 114996977 missense probably benign 0.22
R6931:Itga1 UTSW 13 115001563 missense probably benign 0.39
R7069:Itga1 UTSW 13 114968240 missense probably damaging 1.00
R7458:Itga1 UTSW 13 114986266 missense probably benign 0.00
R7588:Itga1 UTSW 13 114968249 missense possibly damaging 0.88
R7591:Itga1 UTSW 13 114982779 missense probably damaging 1.00
R7597:Itga1 UTSW 13 114974140 missense probably benign 0.28
R7615:Itga1 UTSW 13 114996922 missense probably null 0.99
R7756:Itga1 UTSW 13 114992460 missense probably benign 0.04
R7795:Itga1 UTSW 13 115012236 missense probably damaging 1.00
R7819:Itga1 UTSW 13 115049301 missense probably damaging 0.99
Z1177:Itga1 UTSW 13 114985071 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCTAACCCTGAGACAGCC -3'
(R):5'- AGGTCCCCTTCACTAACTGGTC -3'

Sequencing Primer
(F):5'- TGAGACAGCCCACAGAGCTG -3'
(R):5'- AACTGGTCTTATGCTCAGCCATG -3'
Posted On2016-08-04