Mutagenetix > Incidental Mutations

Incidental Mutation 'R5344:Trio'

422526

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

042923-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5344 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 27735532 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 2824 (R2824Q)

Ref Sequence

ENSEMBL: ENSMUSP00000087714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247]

Predicted Effect

probably benign
Transcript: ENSMUST00000090247
AA Change: R2824Q

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: R2824Q

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226713

Predicted Effect

probably benign
Transcript: ENSMUST00000227030

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227999

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228054

Meta Mutation Damage Score

0.0944

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	G	12: 71,243,027	C1499G	probably benign	Het
Aldoart1	A	G	4: 72,852,115	V152A	possibly damaging	Het
Alms1	T	C	6: 85,696,789	L3591P	probably benign	Het
Ankrd12	A	T	17: 66,049,848	M58K	probably damaging	Het
Asb3	A	C	11: 31,101,114	I523L	probably benign	Het
Ascl2	T	C	7: 142,968,699	H4R	possibly damaging	Het
Asic2	T	C	11: 80,971,587	M246V	probably damaging	Het
Btc	A	T	5: 91,376,920	C53S	possibly damaging	Het
Cdhr5	T	C	7: 141,276,524	I39M	probably damaging	Het
Cdkn3	T	A	14: 46,767,350	M123K	possibly damaging	Het
Cebpz	A	G	17: 78,926,113	Y762H	possibly damaging	Het
Ces1g	T	A	8: 93,337,193		probably benign	Het
Cfap44	T	C	16: 44,416,400		probably null	Het
Chd7	G	T	4: 8,844,417	G1537W	probably damaging	Het
Clca2	A	T	3: 145,087,942	D317E	probably damaging	Het
Clec3a	C	A	8: 114,422,972	N56K	probably damaging	Het
Col11a1	T	A	3: 114,208,362		probably null	Het
Cox20	G	A	1: 178,322,033		probably benign	Het
Cyp2d22	A	G	15: 82,371,638	V471A	possibly damaging	Het
D630045J12Rik	A	G	6: 38,158,228	V1339A	probably damaging	Het
Duox2	T	C	2: 122,281,871	D1278G	probably benign	Het
Epc1	G	A	18: 6,450,614	P284L	probably benign	Het
Evi5l	G	T	8: 4,185,990	R61L	possibly damaging	Het
Fbln2	T	C	6: 91,266,383	Y914H	probably damaging	Het
Fbxo44	A	G	4: 148,153,573	S191P	probably damaging	Het
Fign	A	G	2: 63,979,225	I567T	probably benign	Het
Fryl	C	T	5: 73,104,774	R550K	probably damaging	Het
Gpcpd1	G	A	2: 132,558,677		probably benign	Het
Hectd4	T	C	5: 121,343,676	I3096T	probably benign	Het
Hic2	T	A	16: 17,257,848	D180E	probably benign	Het
Ibtk	A	G	9: 85,735,004	F172L	possibly damaging	Het
Itga1	A	G	13: 115,002,309	S369P	possibly damaging	Het
Itgb4	G	A	11: 115,989,749	R675Q	probably null	Het
Lrrc3b	T	C	14: 15,358,591	D5G	probably damaging	Het
Maml3	T	A	3: 52,103,725	D140V	probably damaging	Het
Med21	A	G	6: 146,649,185	T65A	probably benign	Het
Mta1	T	C	12: 113,131,566		probably benign	Het
Mybpc1	T	C	10: 88,570,568	D152G	probably damaging	Het
Oas1b	C	A	5: 120,822,204	Q325K	probably benign	Het
Olfr1174-ps	A	C	2: 88,310,990	C269G	probably benign	Het
Olfr135	C	A	17: 38,209,104	N286K	probably damaging	Het
Olfr1408	A	G	1: 173,131,106	L37P	probably benign	Het
Pclo	A	G	5: 14,676,612		probably benign	Het
Phactr2	C	T	10: 13,253,616	V233I	possibly damaging	Het
Plekha2	A	T	8: 25,043,047		probably null	Het
Reg3b	A	G	6: 78,372,860	M128V	probably benign	Het
Rnaseh2a	A	G	8: 84,958,106		probably benign	Het
Scn5a	T	C	9: 119,534,007	S516G	probably benign	Het
Serpina12	T	A	12: 104,035,548		probably null	Het
Slc10a1	T	C	12: 80,953,766	T320A	possibly damaging	Het
Slc26a7	A	T	4: 14,519,402	D539E	probably benign	Het
Specc1l	C	A	10: 75,246,173	R485S	possibly damaging	Het
Srp54b	T	G	12: 55,255,581	I339S	probably damaging	Het
Tada1	G	A	1: 166,379,512		probably benign	Het
Trim16	T	C	11: 62,820,925	C54R	probably damaging	Het
Ttpa	A	G	4: 20,021,245	I138V	probably damaging	Het
Ubap2	A	C	4: 41,251,578	M18R	possibly damaging	Het
Usp38	A	G	8: 80,985,763	S548P	possibly damaging	Het
Vmn2r73	T	C	7: 85,875,838	D34G	probably benign	Het
Vps13d	T	A	4: 145,178,334	H74L	probably damaging	Het
Zfp408	C	T	2: 91,645,243	C622Y	probably benign	Het
Zfp616	T	C	11: 74,084,495	I530T	possibly damaging	Het
Zfp9	C	A	6: 118,465,179	C174F	probably damaging	Het
Zfyve16	A	G	13: 92,521,588	I605T	possibly damaging	Het
Zmym5	T	C	14: 56,794,062	T530A	probably damaging	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAAGGCTGAGTACGCACATTTC -3'
(R):5'- CATTCAGGAGTCAGGAAGTCC -3'

Sequencing Primer
(F):5'- TTTCCAGAACCAGGACGTAACTG -3'
(R):5'- TCAGGAAGTCCAGGGTCTGAC -3'

Posted On

2016-08-04