Incidental Mutation 'R5344:Cyp2d22'
ID 422527
Institutional Source Beutler Lab
Gene Symbol Cyp2d22
Ensembl Gene ENSMUSG00000061740
Gene Name cytochrome P450, family 2, subfamily d, polypeptide 22
Synonyms 2D22
MMRRC Submission 042923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R5344 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 82370527-82380260 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82371638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 471 (V471A)
Ref Sequence ENSEMBL: ENSMUSP00000023083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023083] [ENSMUST00000228986]
AlphaFold Q9JKY7
Predicted Effect possibly damaging
Transcript: ENSMUST00000023083
AA Change: V471A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023083
Gene: ENSMUSG00000061740
AA Change: V471A

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:p450 37 497 8.1e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228986
AA Change: V233A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230663
Meta Mutation Damage Score 0.1463 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,243,027 C1499G probably benign Het
Aldoart1 A G 4: 72,852,115 V152A possibly damaging Het
Alms1 T C 6: 85,696,789 L3591P probably benign Het
Ankrd12 A T 17: 66,049,848 M58K probably damaging Het
Asb3 A C 11: 31,101,114 I523L probably benign Het
Ascl2 T C 7: 142,968,699 H4R possibly damaging Het
Asic2 T C 11: 80,971,587 M246V probably damaging Het
Btc A T 5: 91,376,920 C53S possibly damaging Het
Cdhr5 T C 7: 141,276,524 I39M probably damaging Het
Cdkn3 T A 14: 46,767,350 M123K possibly damaging Het
Cebpz A G 17: 78,926,113 Y762H possibly damaging Het
Ces1g T A 8: 93,337,193 probably benign Het
Cfap44 T C 16: 44,416,400 probably null Het
Chd7 G T 4: 8,844,417 G1537W probably damaging Het
Clca2 A T 3: 145,087,942 D317E probably damaging Het
Clec3a C A 8: 114,422,972 N56K probably damaging Het
Col11a1 T A 3: 114,208,362 probably null Het
Cox20 G A 1: 178,322,033 probably benign Het
D630045J12Rik A G 6: 38,158,228 V1339A probably damaging Het
Duox2 T C 2: 122,281,871 D1278G probably benign Het
Epc1 G A 18: 6,450,614 P284L probably benign Het
Evi5l G T 8: 4,185,990 R61L possibly damaging Het
Fbln2 T C 6: 91,266,383 Y914H probably damaging Het
Fbxo44 A G 4: 148,153,573 S191P probably damaging Het
Fign A G 2: 63,979,225 I567T probably benign Het
Fryl C T 5: 73,104,774 R550K probably damaging Het
Gpcpd1 G A 2: 132,558,677 probably benign Het
Hectd4 T C 5: 121,343,676 I3096T probably benign Het
Hic2 T A 16: 17,257,848 D180E probably benign Het
Ibtk A G 9: 85,735,004 F172L possibly damaging Het
Itga1 A G 13: 115,002,309 S369P possibly damaging Het
Itgb4 G A 11: 115,989,749 R675Q probably null Het
Lrrc3b T C 14: 15,358,591 D5G probably damaging Het
Maml3 T A 3: 52,103,725 D140V probably damaging Het
Med21 A G 6: 146,649,185 T65A probably benign Het
Mta1 T C 12: 113,131,566 probably benign Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Oas1b C A 5: 120,822,204 Q325K probably benign Het
Olfr1174-ps A C 2: 88,310,990 C269G probably benign Het
Olfr135 C A 17: 38,209,104 N286K probably damaging Het
Olfr1408 A G 1: 173,131,106 L37P probably benign Het
Pclo A G 5: 14,676,612 probably benign Het
Phactr2 C T 10: 13,253,616 V233I possibly damaging Het
Plekha2 A T 8: 25,043,047 probably null Het
Reg3b A G 6: 78,372,860 M128V probably benign Het
Rnaseh2a A G 8: 84,958,106 probably benign Het
Scn5a T C 9: 119,534,007 S516G probably benign Het
Serpina12 T A 12: 104,035,548 probably null Het
Slc10a1 T C 12: 80,953,766 T320A possibly damaging Het
Slc26a7 A T 4: 14,519,402 D539E probably benign Het
Specc1l C A 10: 75,246,173 R485S possibly damaging Het
Srp54b T G 12: 55,255,581 I339S probably damaging Het
Tada1 G A 1: 166,379,512 probably benign Het
Trim16 T C 11: 62,820,925 C54R probably damaging Het
Trio C T 15: 27,735,532 R2824Q probably benign Het
Ttpa A G 4: 20,021,245 I138V probably damaging Het
Ubap2 A C 4: 41,251,578 M18R possibly damaging Het
Usp38 A G 8: 80,985,763 S548P possibly damaging Het
Vmn2r73 T C 7: 85,875,838 D34G probably benign Het
Vps13d T A 4: 145,178,334 H74L probably damaging Het
Zfp408 C T 2: 91,645,243 C622Y probably benign Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Zfp9 C A 6: 118,465,179 C174F probably damaging Het
Zfyve16 A G 13: 92,521,588 I605T possibly damaging Het
Zmym5 T C 14: 56,794,062 T530A probably damaging Het
Other mutations in Cyp2d22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Cyp2d22 APN 15 82371668 missense probably damaging 1.00
IGL01750:Cyp2d22 APN 15 82374369 missense probably benign 0.12
IGL01801:Cyp2d22 APN 15 82372845 missense probably benign 0.41
IGL02449:Cyp2d22 APN 15 82373241 missense probably benign 0.00
ANU22:Cyp2d22 UTSW 15 82371668 missense probably damaging 1.00
R0165:Cyp2d22 UTSW 15 82373280 missense probably benign 0.06
R0294:Cyp2d22 UTSW 15 82374445 missense possibly damaging 0.86
R1381:Cyp2d22 UTSW 15 82372508 missense probably benign 0.00
R1479:Cyp2d22 UTSW 15 82371936 missense probably damaging 0.97
R1562:Cyp2d22 UTSW 15 82373978 missense probably damaging 0.99
R1968:Cyp2d22 UTSW 15 82373172 missense probably benign 0.04
R1972:Cyp2d22 UTSW 15 82375827 missense probably benign 0.11
R4492:Cyp2d22 UTSW 15 82374370 missense probably benign 0.00
R4575:Cyp2d22 UTSW 15 82371932 missense possibly damaging 0.94
R4702:Cyp2d22 UTSW 15 82375917 missense probably damaging 1.00
R4703:Cyp2d22 UTSW 15 82375917 missense probably damaging 1.00
R5523:Cyp2d22 UTSW 15 82372571 missense probably damaging 1.00
R5888:Cyp2d22 UTSW 15 82373813 missense probably benign
R6060:Cyp2d22 UTSW 15 82375885 missense probably benign 0.00
R6108:Cyp2d22 UTSW 15 82371905 missense possibly damaging 0.59
R6146:Cyp2d22 UTSW 15 82373835 critical splice acceptor site probably null
R6279:Cyp2d22 UTSW 15 82373968 missense probably damaging 1.00
R6563:Cyp2d22 UTSW 15 82371912 missense probably damaging 1.00
R7597:Cyp2d22 UTSW 15 82375852 missense probably damaging 1.00
R7709:Cyp2d22 UTSW 15 82374411 missense possibly damaging 0.88
R7839:Cyp2d22 UTSW 15 82372571 missense probably damaging 1.00
R8094:Cyp2d22 UTSW 15 82374355 missense probably benign 0.19
R8302:Cyp2d22 UTSW 15 82371820 critical splice donor site probably null
R8515:Cyp2d22 UTSW 15 82373912 missense probably benign 0.27
R9245:Cyp2d22 UTSW 15 82372547 missense probably damaging 0.97
R9323:Cyp2d22 UTSW 15 82374006 missense probably damaging 1.00
R9521:Cyp2d22 UTSW 15 82372487 missense probably damaging 1.00
Z1186:Cyp2d22 UTSW 15 82375885 missense probably benign 0.00
Z1190:Cyp2d22 UTSW 15 82375885 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTACAGCCAGGAGATCTCATAG -3'
(R):5'- CTTCATGCCATTCTCAGCAGG -3'

Sequencing Primer
(F):5'- CAGGAGATCTCATAGGGATGATTTAG -3'
(R):5'- ATTCTCAGCAGGTGCCTGG -3'
Posted On 2016-08-04