Incidental Mutation 'R5344:Hic2'
ID422528
Institutional Source Beutler Lab
Gene Symbol Hic2
Ensembl Gene ENSMUSG00000050240
Gene Namehypermethylated in cancer 2
SynonymsHRG22
MMRRC Submission 042923-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.766) question?
Stock #R5344 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17233572-17263430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17257848 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 180 (D180E)
Ref Sequence ENSEMBL: ENSMUSP00000156293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090190] [ENSMUST00000115698] [ENSMUST00000232082]
Predicted Effect probably benign
Transcript: ENSMUST00000090190
AA Change: D180E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000087656
Gene: ENSMUSG00000050240
AA Change: D180E

DomainStartEndE-ValueType
BTB 46 143 6.83e-23 SMART
low complexity region 213 240 N/A INTRINSIC
low complexity region 244 266 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 406 423 N/A INTRINSIC
ZnF_C2H2 446 468 2.49e-1 SMART
low complexity region 477 493 N/A INTRINSIC
ZnF_C2H2 509 531 8.47e-4 SMART
ZnF_C2H2 537 559 2.3e-5 SMART
ZnF_C2H2 565 587 1.13e-4 SMART
ZnF_C2H2 593 615 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115698
AA Change: D180E

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111362
Gene: ENSMUSG00000050240
AA Change: D180E

DomainStartEndE-ValueType
BTB 46 143 6.83e-23 SMART
low complexity region 213 240 N/A INTRINSIC
low complexity region 244 266 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 406 423 N/A INTRINSIC
ZnF_C2H2 446 468 2.49e-1 SMART
low complexity region 477 493 N/A INTRINSIC
ZnF_C2H2 509 531 8.47e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181077
Predicted Effect probably benign
Transcript: ENSMUST00000232082
AA Change: D180E

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232426
Meta Mutation Damage Score 0.1050 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene results in embryonic lethality. A subset of mice heterozygous for a knock-out allele exhibit prenatal lethality and cardiac defects including a ventricular septal defect with overriding aortic valve, and thin myocardial and trabecular layers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,243,027 C1499G probably benign Het
Aldoart1 A G 4: 72,852,115 V152A possibly damaging Het
Alms1 T C 6: 85,696,789 L3591P probably benign Het
Ankrd12 A T 17: 66,049,848 M58K probably damaging Het
Asb3 A C 11: 31,101,114 I523L probably benign Het
Ascl2 T C 7: 142,968,699 H4R possibly damaging Het
Asic2 T C 11: 80,971,587 M246V probably damaging Het
Btc A T 5: 91,376,920 C53S possibly damaging Het
Cdhr5 T C 7: 141,276,524 I39M probably damaging Het
Cdkn3 T A 14: 46,767,350 M123K possibly damaging Het
Cebpz A G 17: 78,926,113 Y762H possibly damaging Het
Ces1g T A 8: 93,337,193 probably benign Het
Cfap44 T C 16: 44,416,400 probably null Het
Chd7 G T 4: 8,844,417 G1537W probably damaging Het
Clca2 A T 3: 145,087,942 D317E probably damaging Het
Clec3a C A 8: 114,422,972 N56K probably damaging Het
Col11a1 T A 3: 114,208,362 probably null Het
Cox20 G A 1: 178,322,033 probably benign Het
Cyp2d22 A G 15: 82,371,638 V471A possibly damaging Het
D630045J12Rik A G 6: 38,158,228 V1339A probably damaging Het
Duox2 T C 2: 122,281,871 D1278G probably benign Het
Epc1 G A 18: 6,450,614 P284L probably benign Het
Evi5l G T 8: 4,185,990 R61L possibly damaging Het
Fbln2 T C 6: 91,266,383 Y914H probably damaging Het
Fbxo44 A G 4: 148,153,573 S191P probably damaging Het
Fign A G 2: 63,979,225 I567T probably benign Het
Fryl C T 5: 73,104,774 R550K probably damaging Het
Gpcpd1 G A 2: 132,558,677 probably benign Het
Hectd4 T C 5: 121,343,676 I3096T probably benign Het
Ibtk A G 9: 85,735,004 F172L possibly damaging Het
Itga1 A G 13: 115,002,309 S369P possibly damaging Het
Itgb4 G A 11: 115,989,749 R675Q probably null Het
Lrrc3b T C 14: 15,358,591 D5G probably damaging Het
Maml3 T A 3: 52,103,725 D140V probably damaging Het
Med21 A G 6: 146,649,185 T65A probably benign Het
Mta1 T C 12: 113,131,566 probably benign Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Oas1b C A 5: 120,822,204 Q325K probably benign Het
Olfr1174-ps A C 2: 88,310,990 C269G probably benign Het
Olfr135 C A 17: 38,209,104 N286K probably damaging Het
Olfr1408 A G 1: 173,131,106 L37P probably benign Het
Pclo A G 5: 14,676,612 probably benign Het
Phactr2 C T 10: 13,253,616 V233I possibly damaging Het
Plekha2 A T 8: 25,043,047 probably null Het
Reg3b A G 6: 78,372,860 M128V probably benign Het
Rnaseh2a A G 8: 84,958,106 probably benign Het
Scn5a T C 9: 119,534,007 S516G probably benign Het
Serpina12 T A 12: 104,035,548 probably null Het
Slc10a1 T C 12: 80,953,766 T320A possibly damaging Het
Slc26a7 A T 4: 14,519,402 D539E probably benign Het
Specc1l C A 10: 75,246,173 R485S possibly damaging Het
Srp54b T G 12: 55,255,581 I339S probably damaging Het
Tada1 G A 1: 166,379,512 probably benign Het
Trim16 T C 11: 62,820,925 C54R probably damaging Het
Trio C T 15: 27,735,532 R2824Q probably benign Het
Ttpa A G 4: 20,021,245 I138V probably damaging Het
Ubap2 A C 4: 41,251,578 M18R possibly damaging Het
Usp38 A G 8: 80,985,763 S548P possibly damaging Het
Vmn2r73 T C 7: 85,875,838 D34G probably benign Het
Vps13d T A 4: 145,178,334 H74L probably damaging Het
Zfp408 C T 2: 91,645,243 C622Y probably benign Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Zfp9 C A 6: 118,465,179 C174F probably damaging Het
Zfyve16 A G 13: 92,521,588 I605T possibly damaging Het
Zmym5 T C 14: 56,794,062 T530A probably damaging Het
Other mutations in Hic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01821:Hic2 APN 16 17257831 missense probably benign 0.00
IGL02021:Hic2 APN 16 17258753 missense probably benign 0.01
IGL02310:Hic2 APN 16 17257757 missense probably damaging 1.00
IGL03049:Hic2 APN 16 17257936 missense probably benign 0.00
R0256:Hic2 UTSW 16 17257513 missense probably benign 0.00
R1433:Hic2 UTSW 16 17258822 missense probably benign
R1771:Hic2 UTSW 16 17258714 missense probably benign 0.43
R1774:Hic2 UTSW 16 17258647 missense probably damaging 1.00
R1954:Hic2 UTSW 16 17258993 missense probably damaging 1.00
R2207:Hic2 UTSW 16 17257460 missense possibly damaging 0.69
R5027:Hic2 UTSW 16 17258747 missense possibly damaging 0.90
R7154:Hic2 UTSW 16 17258942 missense possibly damaging 0.88
R7423:Hic2 UTSW 16 17258129 missense probably damaging 1.00
R7593:Hic2 UTSW 16 17259115 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACTTCATCTACACAGGCAAGC -3'
(R):5'- ACTACTCCCATTGGTGCTGG -3'

Sequencing Primer
(F):5'- AGTGACCAGCCATCTGAGC -3'
(R):5'- CCCATTGGTGCTGGTGCTG -3'
Posted On2016-08-04