Incidental Mutation 'R5345:Ptpn4'
ID422538
Institutional Source Beutler Lab
Gene Symbol Ptpn4
Ensembl Gene ENSMUSG00000026384
Gene Nameprotein tyrosine phosphatase, non-receptor type 4
SynonymsTEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
MMRRC Submission 042924-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R5345 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location119652467-119837613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119765477 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 140 (S140P)
Ref Sequence ENSEMBL: ENSMUSP00000127713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000163179] [ENSMUST00000163435] [ENSMUST00000166422] [ENSMUST00000168303]
Predicted Effect probably benign
Transcript: ENSMUST00000064091
AA Change: S140P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: S140P

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDZ 526 605 2.47e-14 SMART
PTPc 654 913 1.38e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163179
Predicted Effect probably benign
Transcript: ENSMUST00000163435
AA Change: S140P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127713
Gene: ENSMUSG00000026384
AA Change: S140P

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDB:3NFL|D 499 552 4e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000166422
SMART Domains Protein: ENSMUSP00000129180
Gene: ENSMUSG00000026384

DomainStartEndE-ValueType
Pfam:FERM_N 33 85 1.1e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168303
AA Change: S89P
SMART Domains Protein: ENSMUSP00000129521
Gene: ENSMUSG00000026384
AA Change: S89P

DomainStartEndE-ValueType
Pfam:FERM_N 11 75 2.7e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168429
AA Change: S76P
SMART Domains Protein: ENSMUSP00000130299
Gene: ENSMUSG00000026384
AA Change: S76P

DomainStartEndE-ValueType
B41 13 142 9.36e-14 SMART
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,179,177 T158M probably benign Het
Abl1 T A 2: 31,797,047 S519T probably damaging Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acot1 T A 12: 84,017,168 I350N probably damaging Het
Adam8 A G 7: 139,987,639 V397A probably benign Het
Ankar A G 1: 72,670,151 M735T possibly damaging Het
B020031M17Rik A T 13: 119,949,848 V74E probably damaging Het
Cacna1c A G 6: 118,656,536 probably null Het
Cdc25b A G 2: 131,192,596 S222G probably benign Het
Celsr3 T C 9: 108,832,124 S1390P probably damaging Het
Clca4a T G 3: 144,970,461 D104A probably damaging Het
Clcn6 A T 4: 148,038,749 probably benign Het
Coq8b A G 7: 27,250,348 T320A probably benign Het
Cspg5 A T 9: 110,246,630 M145L probably benign Het
Cyp2c67 T A 19: 39,626,232 I284F probably benign Het
Eya4 T C 10: 23,110,048 I565V probably benign Het
Fbxw11 A G 11: 32,738,471 N410S probably damaging Het
Gabrb2 C T 11: 42,626,809 A448V possibly damaging Het
Gm11487 A T 4: 73,401,277 W77R probably damaging Het
Hectd4 A G 5: 121,263,974 D375G possibly damaging Het
Itsn2 T C 12: 4,672,783 V1073A probably damaging Het
Kif5c A G 2: 49,723,066 T139A probably benign Het
L1td1 G A 4: 98,736,447 G293D probably damaging Het
Lama1 A G 17: 67,817,563 M2873V probably benign Het
Myo15 A G 11: 60,497,538 R1960G probably damaging Het
Nbeal1 T C 1: 60,328,210 probably null Het
Ndufb4 A G 16: 37,654,178 probably null Het
Nup153 A T 13: 46,686,865 L1089* probably null Het
Olfr1107 A G 2: 87,071,492 V214A possibly damaging Het
Olfr1512 G A 14: 52,372,268 R262* probably null Het
Olfr168 T A 16: 19,530,777 I48F probably damaging Het
P2rx1 A G 11: 73,009,230 T158A probably damaging Het
Park7 A G 4: 150,908,423 probably benign Het
Parl A T 16: 20,298,142 F102I probably damaging Het
Plxnc1 T A 10: 94,849,969 H720L probably benign Het
Rel A G 11: 23,742,462 S524P probably benign Het
Ripply2 A G 9: 87,019,726 probably null Het
Rps4l-ps T C 7: 114,927,198 noncoding transcript Het
Rtn4ip1 T C 10: 43,932,470 L81P probably damaging Het
Sap130 T C 18: 31,648,198 L138P probably benign Het
Scp2 A T 4: 108,055,579 probably null Het
Sec24c T A 14: 20,693,220 M970K probably benign Het
Setd5 C T 6: 113,116,007 P340L probably damaging Het
Sgcg A T 14: 61,245,769 M61K probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Slc34a1 A G 13: 55,400,518 R21G probably benign Het
Slc7a14 A C 3: 31,223,857 L533W probably damaging Het
Srsf9 A G 5: 115,330,536 D77G probably benign Het
Tab1 A T 15: 80,149,813 E119V possibly damaging Het
Tnrc6c C T 11: 117,723,287 A757V possibly damaging Het
Tradd A T 8: 105,259,924 I72N probably damaging Het
Trbv12-1 C T 6: 41,113,847 T51M probably benign Het
Tsga10 T C 1: 37,763,311 K605E probably damaging Het
Vwc2l A G 1: 70,728,918 D47G probably damaging Het
Zfp647 T A 15: 76,911,495 T322S possibly damaging Het
Zscan20 A C 4: 128,588,121 S583A probably benign Het
Other mutations in Ptpn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ptpn4 APN 1 119659925 splice site probably benign
IGL00885:Ptpn4 APN 1 119802363 missense possibly damaging 0.95
IGL00973:Ptpn4 APN 1 119741371 missense probably benign 0.00
IGL01867:Ptpn4 APN 1 119675599 missense probably benign
IGL01870:Ptpn4 APN 1 119675547 critical splice donor site probably null
IGL02101:Ptpn4 APN 1 119687678 missense probably damaging 1.00
IGL02344:Ptpn4 APN 1 119773260 missense probably damaging 1.00
IGL02348:Ptpn4 APN 1 119682722 missense probably damaging 1.00
IGL02693:Ptpn4 APN 1 119715969 missense probably damaging 0.96
IGL03281:Ptpn4 APN 1 119659912 missense probably damaging 1.00
botched UTSW 1 119743390 missense probably damaging 1.00
bungled UTSW 1 119687605 splice site probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0504:Ptpn4 UTSW 1 119765915 missense probably damaging 1.00
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119675709 splice site probably benign
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1662:Ptpn4 UTSW 1 119765058 missense probably damaging 0.96
R1694:Ptpn4 UTSW 1 119783510 missense probably damaging 0.99
R1733:Ptpn4 UTSW 1 119716043 intron probably null
R2083:Ptpn4 UTSW 1 119687759 missense possibly damaging 0.63
R2226:Ptpn4 UTSW 1 119682785 missense probably damaging 1.00
R2276:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R2277:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R3123:Ptpn4 UTSW 1 119765423 splice site probably null
R3425:Ptpn4 UTSW 1 119707830 missense probably benign 0.02
R4568:Ptpn4 UTSW 1 119680059 missense probably damaging 1.00
R4716:Ptpn4 UTSW 1 119721868 missense probably damaging 1.00
R4819:Ptpn4 UTSW 1 119659850 missense probably benign
R4959:Ptpn4 UTSW 1 119765096 nonsense probably null
R5161:Ptpn4 UTSW 1 119707863 nonsense probably null
R5471:Ptpn4 UTSW 1 119765919 nonsense probably null
R5826:Ptpn4 UTSW 1 119684516 missense probably benign 0.32
R5933:Ptpn4 UTSW 1 119687723 missense probably damaging 0.97
R6075:Ptpn4 UTSW 1 119765136 missense probably damaging 1.00
R6286:Ptpn4 UTSW 1 119721862 critical splice donor site probably null
R6389:Ptpn4 UTSW 1 119721954 missense probably damaging 0.97
R6392:Ptpn4 UTSW 1 119773123 missense probably benign
R6769:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6771:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6794:Ptpn4 UTSW 1 119743390 missense probably damaging 1.00
R6933:Ptpn4 UTSW 1 119773148 intron probably benign
R6967:Ptpn4 UTSW 1 119684581 nonsense probably null
R6980:Ptpn4 UTSW 1 119743421 missense possibly damaging 0.86
R7150:Ptpn4 UTSW 1 119691745 critical splice donor site probably null
R7247:Ptpn4 UTSW 1 119690034 makesense probably null
R7283:Ptpn4 UTSW 1 119682531 missense possibly damaging 0.90
R7459:Ptpn4 UTSW 1 119659834 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACCTAGACATTCATTGAATTACCTC -3'
(R):5'- GCAAGACATTCTTACTGGAAGG -3'

Sequencing Primer
(F):5'- GAATTACCTCAGTAGTTTCTACTTCC -3'
(R):5'- AGATTGGTCTCAACTGGCAGTCATC -3'
Posted On2016-08-04