Incidental Mutation 'R5345:Abl1'
ID422541
Institutional Source Beutler Lab
Gene Symbol Abl1
Ensembl Gene ENSMUSG00000026842
Gene Namec-abl oncogene 1, non-receptor tyrosine kinase
Synonymsc-Abl, E430008G22Rik
MMRRC Submission 042924-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R5345 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31688376-31804227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31797047 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 519 (S519T)
Ref Sequence ENSEMBL: ENSMUSP00000075167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028190] [ENSMUST00000075759] [ENSMUST00000142554]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028190
AA Change: S500T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028190
Gene: ENSMUSG00000026842
AA Change: S500T

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
SH3 64 120 6.95e-16 SMART
SH2 125 208 6.52e-32 SMART
TyrKc 242 493 4.48e-149 SMART
low complexity region 698 703 N/A INTRINSIC
low complexity region 802 810 N/A INTRINSIC
low complexity region 883 907 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 983 N/A INTRINSIC
FABD 997 1123 1.36e-63 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075759
AA Change: S519T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075167
Gene: ENSMUSG00000026842
AA Change: S519T

DomainStartEndE-ValueType
SH3 83 139 6.95e-16 SMART
SH2 144 227 6.52e-32 SMART
TyrKc 261 512 4.48e-149 SMART
low complexity region 717 722 N/A INTRINSIC
low complexity region 821 829 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
low complexity region 968 979 N/A INTRINSIC
low complexity region 983 1002 N/A INTRINSIC
FABD 1016 1142 1.36e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127714
Predicted Effect probably benign
Transcript: ENSMUST00000142554
SMART Domains Protein: ENSMUSP00000142123
Gene: ENSMUSG00000026842

DomainStartEndE-ValueType
PDB:1OPL|B 1 47 2e-27 PDB
Meta Mutation Damage Score 0.1154 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a protooncogene that encodes a protein tyrosine kinase involved in a variety of cellular processes, including cell division, adhesion, differentiation, and response to stress. The activity of the protein is negatively regulated by its SH3 domain, whereby deletion of the region encoding this domain results in an oncogene. The ubiquitously expressed protein has DNA-binding activity that is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function. This gene has been found fused to a variety of translocation partner genes in various leukemias, most notably the t(9;22) translocation that results in a fusion with the 5' end of the breakpoint cluster region gene (BCR; MIM:151410). Alternative splicing of this gene results in two transcript variants, which contain alternative first exons that are spliced to the remaining common exons. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have increased perinatal and postnatal mortality and may display foreshortened crania, abnormal development of spleen, head, heart and eye, reduced B and T cell populations, and osteoporosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,179,177 T158M probably benign Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acot1 T A 12: 84,017,168 I350N probably damaging Het
Adam8 A G 7: 139,987,639 V397A probably benign Het
Ankar A G 1: 72,670,151 M735T possibly damaging Het
B020031M17Rik A T 13: 119,949,848 V74E probably damaging Het
Cacna1c A G 6: 118,656,536 probably null Het
Cdc25b A G 2: 131,192,596 S222G probably benign Het
Celsr3 T C 9: 108,832,124 S1390P probably damaging Het
Clca4a T G 3: 144,970,461 D104A probably damaging Het
Clcn6 A T 4: 148,038,749 probably benign Het
Coq8b A G 7: 27,250,348 T320A probably benign Het
Cspg5 A T 9: 110,246,630 M145L probably benign Het
Cyp2c67 T A 19: 39,626,232 I284F probably benign Het
Eya4 T C 10: 23,110,048 I565V probably benign Het
Fbxw11 A G 11: 32,738,471 N410S probably damaging Het
Gabrb2 C T 11: 42,626,809 A448V possibly damaging Het
Gm11487 A T 4: 73,401,277 W77R probably damaging Het
Hectd4 A G 5: 121,263,974 D375G possibly damaging Het
Itsn2 T C 12: 4,672,783 V1073A probably damaging Het
Kif5c A G 2: 49,723,066 T139A probably benign Het
L1td1 G A 4: 98,736,447 G293D probably damaging Het
Lama1 A G 17: 67,817,563 M2873V probably benign Het
Myo15 A G 11: 60,497,538 R1960G probably damaging Het
Nbeal1 T C 1: 60,328,210 probably null Het
Ndufb4 A G 16: 37,654,178 probably null Het
Nup153 A T 13: 46,686,865 L1089* probably null Het
Olfr1107 A G 2: 87,071,492 V214A possibly damaging Het
Olfr1512 G A 14: 52,372,268 R262* probably null Het
Olfr168 T A 16: 19,530,777 I48F probably damaging Het
P2rx1 A G 11: 73,009,230 T158A probably damaging Het
Park7 A G 4: 150,908,423 probably benign Het
Parl A T 16: 20,298,142 F102I probably damaging Het
Plxnc1 T A 10: 94,849,969 H720L probably benign Het
Ptpn4 A G 1: 119,765,477 S140P probably benign Het
Rel A G 11: 23,742,462 S524P probably benign Het
Ripply2 A G 9: 87,019,726 probably null Het
Rps4l-ps T C 7: 114,927,198 noncoding transcript Het
Rtn4ip1 T C 10: 43,932,470 L81P probably damaging Het
Sap130 T C 18: 31,648,198 L138P probably benign Het
Scp2 A T 4: 108,055,579 probably null Het
Sec24c T A 14: 20,693,220 M970K probably benign Het
Setd5 C T 6: 113,116,007 P340L probably damaging Het
Sgcg A T 14: 61,245,769 M61K probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Slc34a1 A G 13: 55,400,518 R21G probably benign Het
Slc7a14 A C 3: 31,223,857 L533W probably damaging Het
Srsf9 A G 5: 115,330,536 D77G probably benign Het
Tab1 A T 15: 80,149,813 E119V possibly damaging Het
Tnrc6c C T 11: 117,723,287 A757V possibly damaging Het
Tradd A T 8: 105,259,924 I72N probably damaging Het
Trbv12-1 C T 6: 41,113,847 T51M probably benign Het
Tsga10 T C 1: 37,763,311 K605E probably damaging Het
Vwc2l A G 1: 70,728,918 D47G probably damaging Het
Zfp647 T A 15: 76,911,495 T322S possibly damaging Het
Zscan20 A C 4: 128,588,121 S583A probably benign Het
Other mutations in Abl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Abl1 APN 2 31790812 missense probably damaging 1.00
IGL01453:Abl1 APN 2 31778977 missense probably damaging 0.99
IGL02079:Abl1 APN 2 31689948 splice site probably benign
IGL02179:Abl1 APN 2 31792249 missense probably damaging 1.00
IGL02424:Abl1 APN 2 31801132 missense probably benign
IGL02824:Abl1 APN 2 31800819 missense probably damaging 1.00
Hourglass UTSW 2 31794574 missense probably damaging 1.00
Sands UTSW 2 31779010 missense probably damaging 1.00
R0733:Abl1 UTSW 2 31778945 missense probably damaging 1.00
R1222:Abl1 UTSW 2 31800994 missense probably benign
R1428:Abl1 UTSW 2 31801810 missense probably damaging 0.99
R1582:Abl1 UTSW 2 31800359 missense probably damaging 1.00
R1596:Abl1 UTSW 2 31790338 missense probably damaging 0.99
R1824:Abl1 UTSW 2 31800644 missense probably benign 0.01
R2240:Abl1 UTSW 2 31800505 missense probably benign 0.17
R2251:Abl1 UTSW 2 31779119 missense probably damaging 1.00
R2405:Abl1 UTSW 2 31800974 missense possibly damaging 0.50
R2893:Abl1 UTSW 2 31797612 missense probably benign 0.22
R3952:Abl1 UTSW 2 31784537 missense probably damaging 1.00
R4119:Abl1 UTSW 2 31801727 missense probably damaging 1.00
R4210:Abl1 UTSW 2 31801696 missense probably damaging 0.98
R4809:Abl1 UTSW 2 31800242 missense probably damaging 1.00
R4854:Abl1 UTSW 2 31779010 missense probably damaging 1.00
R5518:Abl1 UTSW 2 31790742 missense probably damaging 1.00
R5551:Abl1 UTSW 2 31801670 missense probably benign 0.03
R5568:Abl1 UTSW 2 31779074 missense probably damaging 1.00
R5627:Abl1 UTSW 2 31800583 missense probably benign 0.00
R6435:Abl1 UTSW 2 31801549 missense possibly damaging 0.93
R6492:Abl1 UTSW 2 31801655 missense probably benign 0.38
R6738:Abl1 UTSW 2 31794574 missense probably damaging 1.00
R7310:Abl1 UTSW 2 31800592 missense possibly damaging 0.93
R7398:Abl1 UTSW 2 31790799 missense probably damaging 1.00
R7639:Abl1 UTSW 2 31779161 missense probably damaging 1.00
R7674:Abl1 UTSW 2 31689829 missense possibly damaging 0.91
R7781:Abl1 UTSW 2 31790697 missense probably damaging 1.00
R7802:Abl1 UTSW 2 31760426 missense probably benign
Z1176:Abl1 UTSW 2 31689827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGGACACAGGAGCGTTTGC -3'
(R):5'- ACTGTGTGACTGCACTTCACC -3'

Sequencing Primer
(F):5'- TAGCTTGTCACGGCATCAG -3'
(R):5'- TGTGACTGCACTTCACCCAGAG -3'
Posted On2016-08-04