Incidental Mutation 'R5345:Gabrb2'
ID422569
Institutional Source Beutler Lab
Gene Symbol Gabrb2
Ensembl Gene ENSMUSG00000007653
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 2
SynonymsC030002O17Rik, C030021G16Rik, Gabrb-2
MMRRC Submission 042924-MU
Accession Numbers

Genbank: NM_008070

Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R5345 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location42419757-42629028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42626809 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 448 (A448V)
Ref Sequence ENSEMBL: ENSMUSP00000007797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007797] [ENSMUST00000192403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007797
AA Change: A448V

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000007797
Gene: ENSMUSG00000007653
AA Change: A448V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 8.7e-52 PFAM
Pfam:Neur_chan_memb 249 469 7.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192403
AA Change: A486V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141868
Gene: ENSMUSG00000007653
AA Change: A486V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 1.1e-54 PFAM
Pfam:Neur_chan_memb 249 507 6.6e-55 PFAM
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show hyperactivity and abnormal GABA-mediated receptor currents. Homozygotes for a derivative of this allele show a sexually dimorphic cochlear phenotype associated with OHC dysfunction. Homozygotes for a knock-in allele show altered behavioral response to etomidate. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,179,177 T158M probably benign Het
Abl1 T A 2: 31,797,047 S519T probably damaging Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acot1 T A 12: 84,017,168 I350N probably damaging Het
Adam8 A G 7: 139,987,639 V397A probably benign Het
Ankar A G 1: 72,670,151 M735T possibly damaging Het
B020031M17Rik A T 13: 119,949,848 V74E probably damaging Het
Cacna1c A G 6: 118,656,536 probably null Het
Cdc25b A G 2: 131,192,596 S222G probably benign Het
Celsr3 T C 9: 108,832,124 S1390P probably damaging Het
Clca4a T G 3: 144,970,461 D104A probably damaging Het
Clcn6 A T 4: 148,038,749 probably benign Het
Coq8b A G 7: 27,250,348 T320A probably benign Het
Cspg5 A T 9: 110,246,630 M145L probably benign Het
Cyp2c67 T A 19: 39,626,232 I284F probably benign Het
Eya4 T C 10: 23,110,048 I565V probably benign Het
Fbxw11 A G 11: 32,738,471 N410S probably damaging Het
Gm11487 A T 4: 73,401,277 W77R probably damaging Het
Hectd4 A G 5: 121,263,974 D375G possibly damaging Het
Itsn2 T C 12: 4,672,783 V1073A probably damaging Het
Kif5c A G 2: 49,723,066 T139A probably benign Het
L1td1 G A 4: 98,736,447 G293D probably damaging Het
Lama1 A G 17: 67,817,563 M2873V probably benign Het
Myo15 A G 11: 60,497,538 R1960G probably damaging Het
Nbeal1 T C 1: 60,328,210 probably null Het
Ndufb4 A G 16: 37,654,178 probably null Het
Nup153 A T 13: 46,686,865 L1089* probably null Het
Olfr1107 A G 2: 87,071,492 V214A possibly damaging Het
Olfr1512 G A 14: 52,372,268 R262* probably null Het
Olfr168 T A 16: 19,530,777 I48F probably damaging Het
P2rx1 A G 11: 73,009,230 T158A probably damaging Het
Park7 A G 4: 150,908,423 probably benign Het
Parl A T 16: 20,298,142 F102I probably damaging Het
Plxnc1 T A 10: 94,849,969 H720L probably benign Het
Ptpn4 A G 1: 119,765,477 S140P probably benign Het
Rel A G 11: 23,742,462 S524P probably benign Het
Ripply2 A G 9: 87,019,726 probably null Het
Rps4l-ps T C 7: 114,927,198 noncoding transcript Het
Rtn4ip1 T C 10: 43,932,470 L81P probably damaging Het
Sap130 T C 18: 31,648,198 L138P probably benign Het
Scp2 A T 4: 108,055,579 probably null Het
Sec24c T A 14: 20,693,220 M970K probably benign Het
Setd5 C T 6: 113,116,007 P340L probably damaging Het
Sgcg A T 14: 61,245,769 M61K probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Slc34a1 A G 13: 55,400,518 R21G probably benign Het
Slc7a14 A C 3: 31,223,857 L533W probably damaging Het
Srsf9 A G 5: 115,330,536 D77G probably benign Het
Tab1 A T 15: 80,149,813 E119V possibly damaging Het
Tnrc6c C T 11: 117,723,287 A757V possibly damaging Het
Tradd A T 8: 105,259,924 I72N probably damaging Het
Trbv12-1 C T 6: 41,113,847 T51M probably benign Het
Tsga10 T C 1: 37,763,311 K605E probably damaging Het
Vwc2l A G 1: 70,728,918 D47G probably damaging Het
Zfp647 T A 15: 76,911,495 T322S possibly damaging Het
Zscan20 A C 4: 128,588,121 S583A probably benign Het
Other mutations in Gabrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02275:Gabrb2 APN 11 42591894 missense probably benign 0.00
IGL02666:Gabrb2 APN 11 42529495 critical splice donor site probably null
IGL02983:Gabrb2 APN 11 42421400 missense probably benign 0.00
IGL03357:Gabrb2 APN 11 42591944 missense probably damaging 1.00
H2330:Gabrb2 UTSW 11 42421431 splice site probably benign
R0049:Gabrb2 UTSW 11 42593847 missense probably damaging 1.00
R0049:Gabrb2 UTSW 11 42593847 missense probably damaging 1.00
R0100:Gabrb2 UTSW 11 42487314 missense probably damaging 1.00
R1423:Gabrb2 UTSW 11 42529471 missense probably damaging 1.00
R1526:Gabrb2 UTSW 11 42591888 missense possibly damaging 0.83
R1856:Gabrb2 UTSW 11 42626713 missense probably benign 0.01
R1898:Gabrb2 UTSW 11 42593832 missense possibly damaging 0.51
R2184:Gabrb2 UTSW 11 42421428 critical splice donor site probably null
R2371:Gabrb2 UTSW 11 42591864 missense probably damaging 1.00
R2915:Gabrb2 UTSW 11 42591907 missense probably benign
R2993:Gabrb2 UTSW 11 42597649 missense probably damaging 0.99
R3951:Gabrb2 UTSW 11 42626881 missense probably damaging 1.00
R4167:Gabrb2 UTSW 11 42421328 unclassified probably benign
R4168:Gabrb2 UTSW 11 42421328 unclassified probably benign
R4497:Gabrb2 UTSW 11 42597694 missense probably benign 0.05
R4572:Gabrb2 UTSW 11 42593917 missense possibly damaging 0.46
R4784:Gabrb2 UTSW 11 42597642 missense probably damaging 1.00
R4792:Gabrb2 UTSW 11 42529503 splice site probably benign
R5346:Gabrb2 UTSW 11 42421389 missense probably benign
R5575:Gabrb2 UTSW 11 42529538 intron probably benign
R5701:Gabrb2 UTSW 11 42487374 missense probably damaging 1.00
R5801:Gabrb2 UTSW 11 42421389 missense probably benign 0.00
R5965:Gabrb2 UTSW 11 42626869 missense probably damaging 1.00
R6738:Gabrb2 UTSW 11 42593931 missense possibly damaging 0.95
R6930:Gabrb2 UTSW 11 42597613 missense probably damaging 1.00
R7011:Gabrb2 UTSW 11 42626661 missense possibly damaging 0.76
R7045:Gabrb2 UTSW 11 42593931 missense probably damaging 1.00
R7615:Gabrb2 UTSW 11 42626742 missense probably benign 0.06
R7653:Gabrb2 UTSW 11 42487212 missense probably damaging 1.00
X0020:Gabrb2 UTSW 11 42422646 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AATGCTTGCCTATGATGCCTC -3'
(R):5'- CCCAAATGGTATGAAATGGACCAC -3'

Sequencing Primer
(F):5'- GCCTCCAGCATCCAGTATCG -3'
(R):5'- GGCCAGCAACTAAGGTATTTTAAC -3'
Posted On2016-08-04