Mutagenetix > Incidental Mutation

Incidental Mutation 'R5345:Cyp2c67'

422593

Institutional Source

Beutler Lab

Gene Symbol

Cyp2c67

Ensembl Gene

ENSMUSG00000062624

Gene Name

cytochrome P450, family 2, subfamily c, polypeptide 67

Synonyms

C730004C24Rik

MMRRC Submission

042924-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R5345 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39608842-39649051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 39626232 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 284 (I284F)

Ref Sequence

ENSEMBL: ENSMUSP00000065796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067328]

AlphaFold

Q569X9

Predicted Effect

probably benign
Transcript: ENSMUST00000067328
AA Change: I284F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: I284F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:p450	30	487	8.5e-150	PFAM

Meta Mutation Damage Score

0.0700

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 96.0%

Validation Efficiency

98% (65/66)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	C	T	18: 12,179,177	T158M	probably benign	Het
Abl1	T	A	2: 31,797,047	S519T	probably damaging	Het
Acap2	A	G	16: 31,108,126	S524P	probably benign	Het
Acot1	T	A	12: 84,017,168	I350N	probably damaging	Het
Adam8	A	G	7: 139,987,639	V397A	probably benign	Het
Ankar	A	G	1: 72,670,151	M735T	possibly damaging	Het
B020031M17Rik	A	T	13: 119,949,848	V74E	probably damaging	Het
Cacna1c	A	G	6: 118,656,536		probably null	Het
Cdc25b	A	G	2: 131,192,596	S222G	probably benign	Het
Celsr3	T	C	9: 108,832,124	S1390P	probably damaging	Het
Clca4a	T	G	3: 144,970,461	D104A	probably damaging	Het
Clcn6	A	T	4: 148,038,749		probably benign	Het
Coq8b	A	G	7: 27,250,348	T320A	probably benign	Het
Cspg5	A	T	9: 110,246,630	M145L	probably benign	Het
Eya4	T	C	10: 23,110,048	I565V	probably benign	Het
Fbxw11	A	G	11: 32,738,471	N410S	probably damaging	Het
Gabrb2	C	T	11: 42,626,809	A448V	possibly damaging	Het
Gm11487	A	T	4: 73,401,277	W77R	probably damaging	Het
Hectd4	A	G	5: 121,263,974	D375G	possibly damaging	Het
Itsn2	T	C	12: 4,672,783	V1073A	probably damaging	Het
Kif5c	A	G	2: 49,723,066	T139A	probably benign	Het
L1td1	G	A	4: 98,736,447	G293D	probably damaging	Het
Lama1	A	G	17: 67,817,563	M2873V	probably benign	Het
Myo15	A	G	11: 60,497,538	R1960G	probably damaging	Het
Nbeal1	T	C	1: 60,328,210		probably null	Het
Ndufb4	A	G	16: 37,654,178		probably null	Het
Nup153	A	T	13: 46,686,865	L1089*	probably null	Het
Olfr1107	A	G	2: 87,071,492	V214A	possibly damaging	Het
Olfr1512	G	A	14: 52,372,268	R262*	probably null	Het
Olfr168	T	A	16: 19,530,777	I48F	probably damaging	Het
P2rx1	A	G	11: 73,009,230	T158A	probably damaging	Het
Park7	A	G	4: 150,908,423		probably benign	Het
Parl	A	T	16: 20,298,142	F102I	probably damaging	Het
Plxnc1	T	A	10: 94,849,969	H720L	probably benign	Het
Ptpn4	A	G	1: 119,765,477	S140P	probably benign	Het
Rel	A	G	11: 23,742,462	S524P	probably benign	Het
Ripply2	A	G	9: 87,019,726		probably null	Het
Rps4l-ps	T	C	7: 114,927,198		noncoding transcript	Het
Rtn4ip1	T	C	10: 43,932,470	L81P	probably damaging	Het
Sap130	T	C	18: 31,648,198	L138P	probably benign	Het
Scp2	A	T	4: 108,055,579		probably null	Het
Sec24c	T	A	14: 20,693,220	M970K	probably benign	Het
Setd5	C	T	6: 113,116,007	P340L	probably damaging	Het
Sgcg	A	T	14: 61,245,769	M61K	probably damaging	Het
Slc22a27	C	G	19: 7,865,938	A359P	probably damaging	Het
Slc34a1	A	G	13: 55,400,518	R21G	probably benign	Het
Slc7a14	A	C	3: 31,223,857	L533W	probably damaging	Het
Srsf9	A	G	5: 115,330,536	D77G	probably benign	Het
Tab1	A	T	15: 80,149,813	E119V	possibly damaging	Het
Tnrc6c	C	T	11: 117,723,287	A757V	possibly damaging	Het
Tradd	A	T	8: 105,259,924	I72N	probably damaging	Het
Trbv12-1	C	T	6: 41,113,847	T51M	probably benign	Het
Tsga10	T	C	1: 37,763,311	K605E	probably damaging	Het
Vwc2l	A	G	1: 70,728,918	D47G	probably damaging	Het
Zfp647	T	A	15: 76,911,495	T322S	possibly damaging	Het
Zscan20	A	C	4: 128,588,121	S583A	probably benign	Het

Other mutations in Cyp2c67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Cyp2c67	APN	19	39643385	missense	possibly damaging	0.95
IGL01025:Cyp2c67	APN	19	39639932	nonsense	probably null
IGL01363:Cyp2c67	APN	19	39639967	missense	probably damaging	0.99
IGL01819:Cyp2c67	APN	19	39615721	missense	probably damaging	0.98
IGL01902:Cyp2c67	APN	19	39649026	missense	probably damaging	1.00
IGL02172:Cyp2c67	APN	19	39649002	missense	possibly damaging	0.76
IGL02351:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02355:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02355:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02358:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02362:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02362:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02388:Cyp2c67	APN	19	39643355	missense	probably benign	0.20
IGL03106:Cyp2c67	APN	19	39643675	missense	probably benign	0.27
IGL03219:Cyp2c67	APN	19	39643294	missense	possibly damaging	0.54
IGL03326:Cyp2c67	APN	19	39643269	critical splice donor site	probably null
IGL03349:Cyp2c67	APN	19	39643684	missense	probably damaging	1.00
IGL03356:Cyp2c67	APN	19	39639961	missense	probably damaging	1.00
IGL03052:Cyp2c67	UTSW	19	39648885	missense	possibly damaging	0.88
R0585:Cyp2c67	UTSW	19	39638694	missense	possibly damaging	0.59
R0975:Cyp2c67	UTSW	19	39609178	missense	possibly damaging	0.49
R0976:Cyp2c67	UTSW	19	39643374	missense	probably damaging	1.00
R1252:Cyp2c67	UTSW	19	39626141	missense	possibly damaging	0.93
R1398:Cyp2c67	UTSW	19	39638625	missense	probably damaging	0.96
R1411:Cyp2c67	UTSW	19	39638591	missense	probably damaging	1.00
R1505:Cyp2c67	UTSW	19	39648964	missense	probably benign	0.00
R1543:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1613:Cyp2c67	UTSW	19	39626199	missense	probably benign	0.00
R1618:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1667:Cyp2c67	UTSW	19	39643590	critical splice donor site	probably null
R1852:Cyp2c67	UTSW	19	39617367	missense	probably benign	0.01
R2005:Cyp2c67	UTSW	19	39643345	missense	probably damaging	1.00
R2105:Cyp2c67	UTSW	19	39626237	missense	probably benign	0.24
R2181:Cyp2c67	UTSW	19	39609097	missense	possibly damaging	0.94
R3817:Cyp2c67	UTSW	19	39638683	missense	probably benign	0.00
R4669:Cyp2c67	UTSW	19	39643654	missense	probably benign	0.00
R4689:Cyp2c67	UTSW	19	39638588	missense	probably benign	0.00
R4756:Cyp2c67	UTSW	19	39643744	missense	probably benign	0.03
R4823:Cyp2c67	UTSW	19	39615724	missense	probably benign	0.13
R5152:Cyp2c67	UTSW	19	39638688	missense	probably benign	0.00
R5580:Cyp2c67	UTSW	19	39615650	missense	probably damaging	0.99
R5644:Cyp2c67	UTSW	19	39615694	missense	possibly damaging	0.84
R6116:Cyp2c67	UTSW	19	39617435	missense	probably damaging	1.00
R6516:Cyp2c67	UTSW	19	39617429	missense	probably damaging	1.00
R6550:Cyp2c67	UTSW	19	39617410	nonsense	probably null
R6939:Cyp2c67	UTSW	19	39643334	missense	possibly damaging	0.68
R6995:Cyp2c67	UTSW	19	39615679	missense	probably damaging	0.96
R7028:Cyp2c67	UTSW	19	39639897	missense	possibly damaging	0.68
R7144:Cyp2c67	UTSW	19	39615694	missense	probably benign	0.00
R7242:Cyp2c67	UTSW	19	39617339	missense	probably benign	0.30
R7335:Cyp2c67	UTSW	19	39640007	nonsense	probably null
R7337:Cyp2c67	UTSW	19	39609264	splice site	probably null
R7474:Cyp2c67	UTSW	19	39617432	missense	probably null	0.05
R7642:Cyp2c67	UTSW	19	39615640	missense	probably damaging	0.97
R7870:Cyp2c67	UTSW	19	39609225	missense	probably damaging	1.00
R8152:Cyp2c67	UTSW	19	39640008	missense	probably benign	0.21
R8367:Cyp2c67	UTSW	19	39638674	missense	probably benign	0.01
R8717:Cyp2c67	UTSW	19	39638711	missense	probably benign	0.05
R8728:Cyp2c67	UTSW	19	39626161	missense	probably damaging	1.00
R9275:Cyp2c67	UTSW	19	39609255	missense	probably damaging	1.00
R9278:Cyp2c67	UTSW	19	39609255	missense	probably damaging	1.00
R9376:Cyp2c67	UTSW	19	39638734	missense	probably damaging	1.00
Z1177:Cyp2c67	UTSW	19	39643679	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GACATTTTGAATAACAATGGGCAGG -3'
(R):5'- TGAAGTTTAGACCATCTACACCAC -3'

Sequencing Primer
(F):5'- GGCAGGACACAATCTGCATTGC -3'
(R):5'- TCTACACCACAGTCTCTGAAATGG -3'

Posted On

2016-08-04