Incidental Mutation 'R5346:Ube4b'
ID422604
Institutional Source Beutler Lab
Gene Symbol Ube4b
Ensembl Gene ENSMUSG00000028960
Gene Nameubiquitination factor E4B
SynonymsUFD2a, 4930551I19Rik, Ufd2p, 4933406G05Rik, UFD2, D4Bwg0973e
MMRRC Submission 042925-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5346 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location149328416-149426749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 149337424 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 969 (H969Q)
Ref Sequence ENSEMBL: ENSMUSP00000134452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103212] [ENSMUST00000138181] [ENSMUST00000172836] [ENSMUST00000174343]
Predicted Effect probably benign
Transcript: ENSMUST00000103212
AA Change: H969Q

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099501
Gene: ENSMUSG00000028960
AA Change: H969Q

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 1083 1.3e-199 PFAM
Ubox 1102 1164 3.94e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138181
SMART Domains Protein: ENSMUSP00000122020
Gene: ENSMUSG00000028960

DomainStartEndE-ValueType
Pfam:Ufd2P_core 1 39 1.1e-7 PFAM
Ubox 57 119 3.94e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155845
Predicted Effect possibly damaging
Transcript: ENSMUST00000172836
AA Change: H969Q

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134452
Gene: ENSMUSG00000028960
AA Change: H969Q

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 983 7.4e-143 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174343
SMART Domains Protein: ENSMUSP00000134556
Gene: ENSMUSG00000028960

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die by midgestation and exhibit cardiac development defects such as hemorrhage and cardiomyocyte apoptosis. Heterozygous mice exhibit axonal dystrophy in the nucleus gracilis, degeneration of Purkinje cells and gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T A 5: 62,714,746 Y513F probably benign Het
Cluh C A 11: 74,665,218 H832N probably damaging Het
Cntfr G T 4: 41,675,042 Y21* probably null Het
Cog2 T C 8: 124,546,631 S570P possibly damaging Het
Cops7b A G 1: 86,583,068 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Dopey1 A G 9: 86,520,782 D1345G probably damaging Het
Dqx1 G A 6: 83,059,719 D235N possibly damaging Het
Dscaml1 A G 9: 45,450,559 I206V possibly damaging Het
Ednra T C 8: 77,674,968 Y231C probably damaging Het
Ehhadh T C 16: 21,762,790 Y484C probably damaging Het
Fmnl3 A T 15: 99,331,990 V150D probably damaging Het
Gabrb2 T A 11: 42,421,389 S14T probably benign Het
Gm10608 GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,724 probably null Het
Gpatch2 T C 1: 187,225,868 L140P probably benign Het
Gsdmc A G 15: 63,776,886 Y400H probably damaging Het
Heatr5b A G 17: 78,827,986 S239P probably benign Het
Hmcn1 A T 1: 150,623,244 I4004N probably damaging Het
Insc T A 7: 114,804,541 N63K possibly damaging Het
Mmp28 T C 11: 83,442,663 H484R probably benign Het
Nptn C A 9: 58,623,787 Y64* probably null Het
Nsd2 T A 5: 33,879,136 S655T possibly damaging Het
Nub1 A G 5: 24,697,416 E253G probably damaging Het
Olfr411 T C 11: 74,346,670 R305G probably benign Het
Pde3b T A 7: 114,506,190 H452Q probably benign Het
Pkhd1 T C 1: 20,392,097 M2078V probably benign Het
Pkhd1 T C 1: 20,523,434 D1485G probably damaging Het
Pkhd1l1 A C 15: 44,540,967 T2331P probably damaging Het
Plk5 G A 10: 80,363,108 G433E probably damaging Het
Pnliprp2 T A 19: 58,759,800 D4E probably benign Het
Prag1 A G 8: 36,103,685 D474G probably damaging Het
Psmc1 A G 12: 100,120,100 N332S probably damaging Het
Rad9a G C 19: 4,201,518 probably null Het
Slf1 A G 13: 77,092,371 V396A probably benign Het
Stat6 G A 10: 127,652,313 R312K probably benign Het
Tgm1 A T 14: 55,711,172 V174E probably damaging Het
Tnc A G 4: 64,008,655 V878A probably benign Het
Ubr4 T C 4: 139,428,491 I2209T probably damaging Het
Ulk2 A C 11: 61,834,914 L112R probably damaging Het
Wdr35 T C 12: 8,978,684 Y101H probably benign Het
Xpo7 A G 14: 70,683,677 L617P probably damaging Het
Other mutations in Ube4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Ube4b APN 4 149381366 missense probably benign 0.29
IGL00820:Ube4b APN 4 149352921 splice site probably benign
IGL01093:Ube4b APN 4 149330269 missense probably benign 0.01
IGL01154:Ube4b APN 4 149365470 missense probably benign 0.28
IGL01612:Ube4b APN 4 149383818 missense probably damaging 0.98
IGL01800:Ube4b APN 4 149331494 missense probably damaging 1.00
IGL02149:Ube4b APN 4 149398684 missense possibly damaging 0.88
IGL02472:Ube4b APN 4 149387079 critical splice donor site probably null
IGL02839:Ube4b APN 4 149368399 missense probably damaging 0.98
IGL03027:Ube4b APN 4 149381277 missense probably damaging 1.00
R0143:Ube4b UTSW 4 149355457 missense possibly damaging 0.61
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0206:Ube4b UTSW 4 149398637 missense probably benign 0.38
R0591:Ube4b UTSW 4 149357577 intron probably benign
R1366:Ube4b UTSW 4 149335149 missense probably damaging 0.98
R1452:Ube4b UTSW 4 149371169 missense probably damaging 1.00
R1513:Ube4b UTSW 4 149351578 missense probably benign 0.17
R1668:Ube4b UTSW 4 149361294 missense probably benign 0.02
R1874:Ube4b UTSW 4 149347971 missense probably damaging 1.00
R2002:Ube4b UTSW 4 149383797 missense probably benign 0.16
R2050:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R2109:Ube4b UTSW 4 149372841 missense probably benign 0.00
R2281:Ube4b UTSW 4 149344572 missense probably damaging 1.00
R3547:Ube4b UTSW 4 149335116 missense probably damaging 1.00
R3881:Ube4b UTSW 4 149365404 intron probably null
R4378:Ube4b UTSW 4 149383798 missense probably damaging 1.00
R4563:Ube4b UTSW 4 149359165 intron probably benign
R4674:Ube4b UTSW 4 149331370 missense possibly damaging 0.86
R4716:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R5026:Ube4b UTSW 4 149360565 missense probably damaging 1.00
R5125:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5178:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5182:Ube4b UTSW 4 149381242 missense probably null 0.08
R5229:Ube4b UTSW 4 149387178 missense probably damaging 1.00
R5303:Ube4b UTSW 4 149383803 missense probably damaging 0.98
R5780:Ube4b UTSW 4 149331364 missense probably benign 0.00
R5813:Ube4b UTSW 4 149337468 missense probably damaging 1.00
R5842:Ube4b UTSW 4 149331430 missense probably benign 0.01
R5994:Ube4b UTSW 4 149372932 missense probably damaging 0.97
R6020:Ube4b UTSW 4 149368311 missense probably benign 0.17
R6125:Ube4b UTSW 4 149398746 missense probably benign 0.13
R6272:Ube4b UTSW 4 149387133 missense probably damaging 1.00
R6333:Ube4b UTSW 4 149348037 missense probably damaging 1.00
R6426:Ube4b UTSW 4 149425996 unclassified probably benign
R7203:Ube4b UTSW 4 149398610 missense probably benign 0.30
R7341:Ube4b UTSW 4 149343001 missense probably damaging 1.00
R7672:Ube4b UTSW 4 149387204 missense probably benign 0.10
R7713:Ube4b UTSW 4 149398781 missense possibly damaging 0.53
Z1088:Ube4b UTSW 4 149335125 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGTGATGTGGACCAACTGGG -3'
(R):5'- TCCTTCACACTTGGCCAAG -3'

Sequencing Primer
(F):5'- GGCTATACAGAGAAACCCTGTCTTG -3'
(R):5'- GCCAAGTGTTCTGAGTAGCC -3'
Posted On2016-08-04