Incidental Mutation 'R5346:Prag1'
ID422613
Institutional Source Beutler Lab
Gene Symbol Prag1
Ensembl Gene ENSMUSG00000050271
Gene NamePEAK1 related kinase activating pseudokinase 1
SynonymsD8Ertd82e, NACK
MMRRC Submission 042925-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5346 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location36094828-36147787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36103685 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 474 (D474G)
Ref Sequence ENSEMBL: ENSMUSP00000106118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110492]
Predicted Effect probably damaging
Transcript: ENSMUST00000110492
AA Change: D474G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106118
Gene: ENSMUSG00000050271
AA Change: D474G

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 395 412 N/A INTRINSIC
low complexity region 525 544 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 892 925 N/A INTRINSIC
Pfam:Pkinase_Tyr 1060 1288 1.7e-7 PFAM
Pfam:Pkinase 1061 1293 1.5e-13 PFAM
low complexity region 1363 1373 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150295
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the tyrosine protein kinase family. A similar protein in rat binds to Rho family GTPase 2 (Rnd2) and regulates neurite outgrowth via activation of Ras homolog gene family, member A (RhoA). [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T A 5: 62,714,746 Y513F probably benign Het
Cluh C A 11: 74,665,218 H832N probably damaging Het
Cntfr G T 4: 41,675,042 Y21* probably null Het
Cog2 T C 8: 124,546,631 S570P possibly damaging Het
Cops7b A G 1: 86,583,068 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Dopey1 A G 9: 86,520,782 D1345G probably damaging Het
Dqx1 G A 6: 83,059,719 D235N possibly damaging Het
Dscaml1 A G 9: 45,450,559 I206V possibly damaging Het
Ednra T C 8: 77,674,968 Y231C probably damaging Het
Ehhadh T C 16: 21,762,790 Y484C probably damaging Het
Fmnl3 A T 15: 99,331,990 V150D probably damaging Het
Gabrb2 T A 11: 42,421,389 S14T probably benign Het
Gm10608 GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,724 probably null Het
Gpatch2 T C 1: 187,225,868 L140P probably benign Het
Gsdmc A G 15: 63,776,886 Y400H probably damaging Het
Heatr5b A G 17: 78,827,986 S239P probably benign Het
Hmcn1 A T 1: 150,623,244 I4004N probably damaging Het
Insc T A 7: 114,804,541 N63K possibly damaging Het
Mmp28 T C 11: 83,442,663 H484R probably benign Het
Nptn C A 9: 58,623,787 Y64* probably null Het
Nsd2 T A 5: 33,879,136 S655T possibly damaging Het
Nub1 A G 5: 24,697,416 E253G probably damaging Het
Olfr411 T C 11: 74,346,670 R305G probably benign Het
Pde3b T A 7: 114,506,190 H452Q probably benign Het
Pkhd1 T C 1: 20,392,097 M2078V probably benign Het
Pkhd1 T C 1: 20,523,434 D1485G probably damaging Het
Pkhd1l1 A C 15: 44,540,967 T2331P probably damaging Het
Plk5 G A 10: 80,363,108 G433E probably damaging Het
Pnliprp2 T A 19: 58,759,800 D4E probably benign Het
Psmc1 A G 12: 100,120,100 N332S probably damaging Het
Rad9a G C 19: 4,201,518 probably null Het
Slf1 A G 13: 77,092,371 V396A probably benign Het
Stat6 G A 10: 127,652,313 R312K probably benign Het
Tgm1 A T 14: 55,711,172 V174E probably damaging Het
Tnc A G 4: 64,008,655 V878A probably benign Het
Ube4b A T 4: 149,337,424 H969Q possibly damaging Het
Ubr4 T C 4: 139,428,491 I2209T probably damaging Het
Ulk2 A C 11: 61,834,914 L112R probably damaging Het
Wdr35 T C 12: 8,978,684 Y101H probably benign Het
Xpo7 A G 14: 70,683,677 L617P probably damaging Het
Other mutations in Prag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Prag1 APN 8 36099931 missense probably benign 0.01
IGL01132:Prag1 APN 8 36146357 missense probably damaging 1.00
IGL01322:Prag1 APN 8 36103934 missense probably benign 0.01
IGL01343:Prag1 APN 8 36103046 missense possibly damaging 0.95
IGL01726:Prag1 APN 8 36102992 missense probably damaging 1.00
IGL01739:Prag1 APN 8 36102680 missense probably benign 0.00
IGL02420:Prag1 APN 8 36147426 utr 3 prime probably benign
IGL02433:Prag1 APN 8 36139568 missense probably damaging 1.00
IGL02627:Prag1 APN 8 36139439 missense possibly damaging 0.93
IGL02797:Prag1 APN 8 36139501 missense probably damaging 1.00
IGL03070:Prag1 APN 8 36103549 missense probably benign 0.01
IGL03323:Prag1 APN 8 36140008 missense probably damaging 1.00
FR4340:Prag1 UTSW 8 36103886 small insertion probably benign
FR4548:Prag1 UTSW 8 36103885 small insertion probably benign
FR4589:Prag1 UTSW 8 36103883 small insertion probably benign
FR4976:Prag1 UTSW 8 36103883 small insertion probably benign
R0325:Prag1 UTSW 8 36103804 missense probably benign 0.00
R0486:Prag1 UTSW 8 36146633 missense probably damaging 1.00
R0506:Prag1 UTSW 8 36103700 missense possibly damaging 0.92
R0507:Prag1 UTSW 8 36104123 missense probably damaging 1.00
R0595:Prag1 UTSW 8 36147002 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0885:Prag1 UTSW 8 36103267 missense probably benign 0.00
R1015:Prag1 UTSW 8 36146543 missense probably damaging 1.00
R1168:Prag1 UTSW 8 36146645 missense probably damaging 1.00
R1182:Prag1 UTSW 8 36147259 missense possibly damaging 0.95
R1227:Prag1 UTSW 8 36139951 missense probably damaging 1.00
R1282:Prag1 UTSW 8 36099914 missense probably damaging 0.96
R1469:Prag1 UTSW 8 36146298 splice site probably benign
R1656:Prag1 UTSW 8 36104346 missense probably damaging 1.00
R1660:Prag1 UTSW 8 36140023 missense possibly damaging 0.73
R1676:Prag1 UTSW 8 36102898 missense probably damaging 0.96
R1820:Prag1 UTSW 8 36103804 missense probably benign 0.00
R1970:Prag1 UTSW 8 36129160 splice site probably null
R1974:Prag1 UTSW 8 36102927 missense probably damaging 1.00
R4398:Prag1 UTSW 8 36103655 missense probably damaging 1.00
R4429:Prag1 UTSW 8 36146642 missense probably damaging 1.00
R4627:Prag1 UTSW 8 36103292 missense probably damaging 1.00
R4980:Prag1 UTSW 8 36139586 missense probably damaging 1.00
R5131:Prag1 UTSW 8 36139969 missense probably damaging 1.00
R5215:Prag1 UTSW 8 36099889 missense probably benign 0.06
R5414:Prag1 UTSW 8 36139622 missense probably benign 0.00
R5535:Prag1 UTSW 8 36104014 missense probably benign
R5687:Prag1 UTSW 8 36146813 missense probably benign 0.02
R5785:Prag1 UTSW 8 36103487 missense probably benign 0.35
R5817:Prag1 UTSW 8 36103703 missense probably damaging 1.00
R6002:Prag1 UTSW 8 36104183 missense probably benign 0.31
R6127:Prag1 UTSW 8 36147401 missense unknown
R6240:Prag1 UTSW 8 36103352 missense probably benign 0.03
R6277:Prag1 UTSW 8 36146591 missense probably damaging 1.00
R6326:Prag1 UTSW 8 36102706 missense possibly damaging 0.79
R6741:Prag1 UTSW 8 36147280 missense probably benign 0.41
R6925:Prag1 UTSW 8 36103894 missense probably damaging 1.00
R7085:Prag1 UTSW 8 36104237 missense possibly damaging 0.71
R7095:Prag1 UTSW 8 36102560 missense probably benign
R7204:Prag1 UTSW 8 36146761 missense probably benign 0.03
R7213:Prag1 UTSW 8 36146615 missense probably damaging 0.99
R7567:Prag1 UTSW 8 36102606 missense possibly damaging 0.68
R7577:Prag1 UTSW 8 36146942 missense probably damaging 1.00
R7783:Prag1 UTSW 8 36103255 missense possibly damaging 0.66
Z1177:Prag1 UTSW 8 36147142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGCCAGGGCCAAGTATG -3'
(R):5'- ACAAAAGTTGGGGTCCGAC -3'

Sequencing Primer
(F):5'- GATTCAGAAGACACCCCCT -3'
(R):5'- CGTCGCTGTGGTCAGTCAG -3'
Posted On2016-08-04