Incidental Mutation 'R5346:Cog2'
ID422615
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Namecomponent of oligomeric golgi complex 2
Synonyms2700012E02Rik, 1190002B08Rik, Cog2
MMRRC Submission 042925-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5346 (G1)
Quality Score213
Status Not validated
Chromosome8
Chromosomal Location124520767-124552008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124546631 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 570 (S570P)
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034460
AA Change: S570P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: S570P

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129977
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T A 5: 62,714,746 Y513F probably benign Het
Cluh C A 11: 74,665,218 H832N probably damaging Het
Cntfr G T 4: 41,675,042 Y21* probably null Het
Cops7b A G 1: 86,583,068 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Dopey1 A G 9: 86,520,782 D1345G probably damaging Het
Dqx1 G A 6: 83,059,719 D235N possibly damaging Het
Dscaml1 A G 9: 45,450,559 I206V possibly damaging Het
Ednra T C 8: 77,674,968 Y231C probably damaging Het
Ehhadh T C 16: 21,762,790 Y484C probably damaging Het
Fmnl3 A T 15: 99,331,990 V150D probably damaging Het
Gabrb2 T A 11: 42,421,389 S14T probably benign Het
Gm10608 GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,724 probably null Het
Gpatch2 T C 1: 187,225,868 L140P probably benign Het
Gsdmc A G 15: 63,776,886 Y400H probably damaging Het
Heatr5b A G 17: 78,827,986 S239P probably benign Het
Hmcn1 A T 1: 150,623,244 I4004N probably damaging Het
Insc T A 7: 114,804,541 N63K possibly damaging Het
Mmp28 T C 11: 83,442,663 H484R probably benign Het
Nptn C A 9: 58,623,787 Y64* probably null Het
Nsd2 T A 5: 33,879,136 S655T possibly damaging Het
Nub1 A G 5: 24,697,416 E253G probably damaging Het
Olfr411 T C 11: 74,346,670 R305G probably benign Het
Pde3b T A 7: 114,506,190 H452Q probably benign Het
Pkhd1 T C 1: 20,392,097 M2078V probably benign Het
Pkhd1 T C 1: 20,523,434 D1485G probably damaging Het
Pkhd1l1 A C 15: 44,540,967 T2331P probably damaging Het
Plk5 G A 10: 80,363,108 G433E probably damaging Het
Pnliprp2 T A 19: 58,759,800 D4E probably benign Het
Prag1 A G 8: 36,103,685 D474G probably damaging Het
Psmc1 A G 12: 100,120,100 N332S probably damaging Het
Rad9a G C 19: 4,201,518 probably null Het
Slf1 A G 13: 77,092,371 V396A probably benign Het
Stat6 G A 10: 127,652,313 R312K probably benign Het
Tgm1 A T 14: 55,711,172 V174E probably damaging Het
Tnc A G 4: 64,008,655 V878A probably benign Het
Ube4b A T 4: 149,337,424 H969Q possibly damaging Het
Ubr4 T C 4: 139,428,491 I2209T probably damaging Het
Ulk2 A C 11: 61,834,914 L112R probably damaging Het
Wdr35 T C 12: 8,978,684 Y101H probably benign Het
Xpo7 A G 14: 70,683,677 L617P probably damaging Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 124545243 missense probably benign 0.00
IGL01092:Cog2 APN 8 124545280 missense probably damaging 1.00
IGL01150:Cog2 APN 8 124542891 missense possibly damaging 0.62
IGL02052:Cog2 APN 8 124542888 critical splice acceptor site probably null
IGL02308:Cog2 APN 8 124533212 critical splice acceptor site probably null
IGL02543:Cog2 APN 8 124529959 missense probably benign 0.09
IGL02978:Cog2 APN 8 124550336 missense probably benign
IGL03008:Cog2 APN 8 124535392 splice site probably benign
IGL03144:Cog2 APN 8 124541024 missense probably damaging 0.98
kugge UTSW 8 124550232 missense probably damaging 1.00
Pelota UTSW 8 124550306 missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 124545271 missense probably benign 0.22
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0110:Cog2 UTSW 8 124529058 critical splice donor site probably null
R0436:Cog2 UTSW 8 124548514 splice site probably benign
R0450:Cog2 UTSW 8 124529058 critical splice donor site probably null
R1365:Cog2 UTSW 8 124540974 missense probably damaging 0.97
R1661:Cog2 UTSW 8 124542890 missense probably benign 0.20
R1698:Cog2 UTSW 8 124525683 missense probably damaging 1.00
R1856:Cog2 UTSW 8 124551403 missense possibly damaging 0.93
R2122:Cog2 UTSW 8 124528985 missense possibly damaging 0.91
R2398:Cog2 UTSW 8 124529926 missense probably benign 0.07
R3855:Cog2 UTSW 8 124530003 critical splice donor site probably null
R4580:Cog2 UTSW 8 124545136 missense probably benign 0.01
R4803:Cog2 UTSW 8 124535451 missense probably damaging 0.96
R5316:Cog2 UTSW 8 124529040 missense probably benign 0.14
R5394:Cog2 UTSW 8 124532529 missense probably benign 0.00
R5395:Cog2 UTSW 8 124545221 missense probably benign 0.00
R5738:Cog2 UTSW 8 124546038 missense probably benign 0.03
R5861:Cog2 UTSW 8 124537878 missense probably damaging 1.00
R5894:Cog2 UTSW 8 124545267 missense probably benign 0.00
R5941:Cog2 UTSW 8 124546086 missense probably benign
R6186:Cog2 UTSW 8 124546686 missense probably damaging 1.00
R6400:Cog2 UTSW 8 124550306 missense probably damaging 1.00
R6518:Cog2 UTSW 8 124527103 nonsense probably null
R6558:Cog2 UTSW 8 124550232 missense probably damaging 1.00
R6717:Cog2 UTSW 8 124525749 missense probably damaging 1.00
R6902:Cog2 UTSW 8 124546691 missense probably damaging 1.00
R6914:Cog2 UTSW 8 124545136 missense probably benign 0.00
R6942:Cog2 UTSW 8 124545136 missense probably benign 0.00
R7103:Cog2 UTSW 8 124541114 critical splice donor site probably null
R7274:Cog2 UTSW 8 124535519 missense possibly damaging 0.71
R7641:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R7674:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R8559:Cog2 UTSW 8 124542908 missense probably benign 0.25
X0026:Cog2 UTSW 8 124546020 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTAAATCCTTAGCTGTCTCAGTG -3'
(R):5'- AGTTGAGCTTGCTCCTGACC -3'

Sequencing Primer
(F):5'- CTAATGAACTGATTTGCTAGCACAC -3'
(R):5'- TGACCCTCCCGAGTCCTG -3'
Posted On2016-08-04