Mutagenetix > Incidental Mutation

Incidental Mutation 'R5346:Cog2'

422615

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

042925-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5346 (G1)

Quality Score

213

Status

Not validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124546631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 570 (S570P)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034460
AA Change: S570P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: S570P

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129977

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	T	A	5: 62,714,746	Y513F	probably benign	Het
Cluh	C	A	11: 74,665,218	H832N	probably damaging	Het
Cntfr	G	T	4: 41,675,042	Y21*	probably null	Het
Cops7b	A	G	1: 86,583,068		probably benign	Het
Cpox	G	A	16: 58,675,286	G322D	probably damaging	Het
Dopey1	A	G	9: 86,520,782	D1345G	probably damaging	Het
Dqx1	G	A	6: 83,059,719	D235N	possibly damaging	Het
Dscaml1	A	G	9: 45,450,559	I206V	possibly damaging	Het
Ednra	T	C	8: 77,674,968	Y231C	probably damaging	Het
Ehhadh	T	C	16: 21,762,790	Y484C	probably damaging	Het
Fmnl3	A	T	15: 99,331,990	V150D	probably damaging	Het
Gabrb2	T	A	11: 42,421,389	S14T	probably benign	Het
Gm10608	GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,724		probably null	Het
Gpatch2	T	C	1: 187,225,868	L140P	probably benign	Het
Gsdmc	A	G	15: 63,776,886	Y400H	probably damaging	Het
Heatr5b	A	G	17: 78,827,986	S239P	probably benign	Het
Hmcn1	A	T	1: 150,623,244	I4004N	probably damaging	Het
Insc	T	A	7: 114,804,541	N63K	possibly damaging	Het
Mmp28	T	C	11: 83,442,663	H484R	probably benign	Het
Nptn	C	A	9: 58,623,787	Y64*	probably null	Het
Nsd2	T	A	5: 33,879,136	S655T	possibly damaging	Het
Nub1	A	G	5: 24,697,416	E253G	probably damaging	Het
Olfr411	T	C	11: 74,346,670	R305G	probably benign	Het
Pde3b	T	A	7: 114,506,190	H452Q	probably benign	Het
Pkhd1	T	C	1: 20,392,097	M2078V	probably benign	Het
Pkhd1	T	C	1: 20,523,434	D1485G	probably damaging	Het
Pkhd1l1	A	C	15: 44,540,967	T2331P	probably damaging	Het
Plk5	G	A	10: 80,363,108	G433E	probably damaging	Het
Pnliprp2	T	A	19: 58,759,800	D4E	probably benign	Het
Prag1	A	G	8: 36,103,685	D474G	probably damaging	Het
Psmc1	A	G	12: 100,120,100	N332S	probably damaging	Het
Rad9a	G	C	19: 4,201,518		probably null	Het
Slf1	A	G	13: 77,092,371	V396A	probably benign	Het
Stat6	G	A	10: 127,652,313	R312K	probably benign	Het
Tgm1	A	T	14: 55,711,172	V174E	probably damaging	Het
Tnc	A	G	4: 64,008,655	V878A	probably benign	Het
Ube4b	A	T	4: 149,337,424	H969Q	possibly damaging	Het
Ubr4	T	C	4: 139,428,491	I2209T	probably damaging	Het
Ulk2	A	C	11: 61,834,914	L112R	probably damaging	Het
Wdr35	T	C	12: 8,978,684	Y101H	probably benign	Het
Xpo7	A	G	14: 70,683,677	L617P	probably damaging	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGTAAATCCTTAGCTGTCTCAGTG -3'
(R):5'- AGTTGAGCTTGCTCCTGACC -3'

Sequencing Primer
(F):5'- CTAATGAACTGATTTGCTAGCACAC -3'
(R):5'- TGACCCTCCCGAGTCCTG -3'

Posted On

2016-08-04