Incidental Mutation 'R5346:Mmp28'
ID422628
Institutional Source Beutler Lab
Gene Symbol Mmp28
Ensembl Gene ENSMUSG00000020682
Gene Namematrix metallopeptidase 28 (epilysin)
Synonymsepilysin
MMRRC Submission 042925-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5346 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83440768-83463071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83442663 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 484 (H484R)
Ref Sequence ENSEMBL: ENSMUSP00000103772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021020] [ENSMUST00000037378] [ENSMUST00000103209] [ENSMUST00000108137] [ENSMUST00000119346] [ENSMUST00000188702]
Predicted Effect probably benign
Transcript: ENSMUST00000021020
AA Change: H474R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021020
Gene: ENSMUSG00000020682
AA Change: H474R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 1e-11 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 361 7.46e0 SMART
HX 363 406 1.64e-1 SMART
HX 408 454 1.78e-2 SMART
HX 456 500 5.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037378
SMART Domains Protein: ENSMUSP00000042098
Gene: ENSMUSG00000035085

DomainStartEndE-ValueType
Pfam:DUF4637 5 169 1.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103209
AA Change: H460R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099498
Gene: ENSMUSG00000020682
AA Change: H460R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 9.7e-12 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 349 392 1.64e-1 SMART
HX 394 440 1.78e-2 SMART
HX 442 486 5.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108137
AA Change: H484R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103772
Gene: ENSMUSG00000020682
AA Change: H484R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 2.6e-11 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 371 2.72e-7 SMART
HX 373 416 1.64e-1 SMART
HX 418 464 1.78e-2 SMART
HX 466 510 5.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119346
SMART Domains Protein: ENSMUSP00000112566
Gene: ENSMUSG00000020682

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 7.4e-12 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 371 2.72e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188702
SMART Domains Protein: ENSMUSP00000140664
Gene: ENSMUSG00000035085

DomainStartEndE-ValueType
Pfam:DUF4637 6 111 2.8e-48 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix for both normal physiological processes, such as embryonic development, reproduction and tissue remodeling, and disease processes, such as asthma and metastasis. This gene encodes a secreted enzyme that degrades casein. Its expression pattern suggests that it plays a role in tissue homeostasis and in wound repair. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Null homozygote mice have enhanced chemotaxis of macrophages into the lung upon infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T A 5: 62,714,746 Y513F probably benign Het
Cluh C A 11: 74,665,218 H832N probably damaging Het
Cntfr G T 4: 41,675,042 Y21* probably null Het
Cog2 T C 8: 124,546,631 S570P possibly damaging Het
Cops7b A G 1: 86,583,068 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Dopey1 A G 9: 86,520,782 D1345G probably damaging Het
Dqx1 G A 6: 83,059,719 D235N possibly damaging Het
Dscaml1 A G 9: 45,450,559 I206V possibly damaging Het
Ednra T C 8: 77,674,968 Y231C probably damaging Het
Ehhadh T C 16: 21,762,790 Y484C probably damaging Het
Fmnl3 A T 15: 99,331,990 V150D probably damaging Het
Gabrb2 T A 11: 42,421,389 S14T probably benign Het
Gm10608 GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,724 probably null Het
Gpatch2 T C 1: 187,225,868 L140P probably benign Het
Gsdmc A G 15: 63,776,886 Y400H probably damaging Het
Heatr5b A G 17: 78,827,986 S239P probably benign Het
Hmcn1 A T 1: 150,623,244 I4004N probably damaging Het
Insc T A 7: 114,804,541 N63K possibly damaging Het
Nptn C A 9: 58,623,787 Y64* probably null Het
Nsd2 T A 5: 33,879,136 S655T possibly damaging Het
Nub1 A G 5: 24,697,416 E253G probably damaging Het
Olfr411 T C 11: 74,346,670 R305G probably benign Het
Pde3b T A 7: 114,506,190 H452Q probably benign Het
Pkhd1 T C 1: 20,392,097 M2078V probably benign Het
Pkhd1 T C 1: 20,523,434 D1485G probably damaging Het
Pkhd1l1 A C 15: 44,540,967 T2331P probably damaging Het
Plk5 G A 10: 80,363,108 G433E probably damaging Het
Pnliprp2 T A 19: 58,759,800 D4E probably benign Het
Prag1 A G 8: 36,103,685 D474G probably damaging Het
Psmc1 A G 12: 100,120,100 N332S probably damaging Het
Rad9a G C 19: 4,201,518 probably null Het
Slf1 A G 13: 77,092,371 V396A probably benign Het
Stat6 G A 10: 127,652,313 R312K probably benign Het
Tgm1 A T 14: 55,711,172 V174E probably damaging Het
Tnc A G 4: 64,008,655 V878A probably benign Het
Ube4b A T 4: 149,337,424 H969Q possibly damaging Het
Ubr4 T C 4: 139,428,491 I2209T probably damaging Het
Ulk2 A C 11: 61,834,914 L112R probably damaging Het
Wdr35 T C 12: 8,978,684 Y101H probably benign Het
Xpo7 A G 14: 70,683,677 L617P probably damaging Het
Other mutations in Mmp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Mmp28 APN 11 83443776 missense possibly damaging 0.93
IGL02559:Mmp28 APN 11 83447740 missense probably benign 0.00
R0399:Mmp28 UTSW 11 83451732 missense probably damaging 1.00
R0492:Mmp28 UTSW 11 83443803 missense probably damaging 1.00
R1432:Mmp28 UTSW 11 83442939 missense probably damaging 1.00
R1822:Mmp28 UTSW 11 83444219 missense probably damaging 0.99
R2181:Mmp28 UTSW 11 83442717 missense possibly damaging 0.92
R5532:Mmp28 UTSW 11 83442858 missense probably damaging 1.00
R5548:Mmp28 UTSW 11 83443907 nonsense probably null
R7580:Mmp28 UTSW 11 83444832 missense probably damaging 0.98
R7882:Mmp28 UTSW 11 83443926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAAAGTCCAGGGGCTTC -3'
(R):5'- ACAGGGAATCGTTGTTGGAG -3'

Sequencing Primer
(F):5'- TCCAGGGGCTTCCTAGACAG -3'
(R):5'- AGGTTCCAGGGCACGAAGTC -3'
Posted On2016-08-04