Incidental Mutation 'R5347:Hectd4'
ID422663
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene NameHECT domain E3 ubiquitin protein ligase 4
SynonymsGm15800
MMRRC Submission 042926-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R5347 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121220219-121368577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121304448 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1317 (I1317T)
Ref Sequence ENSEMBL: ENSMUSP00000048345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614] [ENSMUST00000100769]
Predicted Effect probably benign
Transcript: ENSMUST00000042614
AA Change: I1317T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: I1317T

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100769
SMART Domains Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
low complexity region 214 225 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128514
Predicted Effect probably benign
Transcript: ENSMUST00000148368
Predicted Effect unknown
Transcript: ENSMUST00000201669
AA Change: I677T
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,892,154 Y233C probably damaging Het
Agl A G 3: 116,791,165 S169P probably damaging Het
Arid1b C T 17: 5,291,057 Q879* probably null Het
Bbs2 A G 8: 94,092,550 S64P probably damaging Het
BC027072 A G 17: 71,749,935 S916P probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Cacna2d2 A G 9: 107,514,114 T447A probably benign Het
Ccdc169 A T 3: 55,142,319 probably benign Het
Cdan1 A G 2: 120,730,065 S275P possibly damaging Het
Cdh15 A G 8: 122,862,063 N292S probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnnm1 A G 19: 43,441,862 H473R probably benign Het
Cplx4 G A 18: 65,970,086 probably benign Het
Crb1 C T 1: 139,337,371 G103E probably damaging Het
Diexf A T 1: 193,128,379 D105E probably benign Het
Dnaja3 T A 16: 4,694,482 V250E possibly damaging Het
Dync2h1 T G 9: 7,129,727 Q1757P probably damaging Het
Edem3 A G 1: 151,807,451 Q626R probably damaging Het
Eif2b1 T C 5: 124,578,799 probably benign Het
Esf1 T A 2: 140,154,881 K521* probably null Het
Fam160b1 A G 19: 57,378,619 D198G probably benign Het
Fbxl3 A C 14: 103,083,294 V239G probably damaging Het
Fto A G 8: 91,391,479 probably benign Het
Gm5773 T C 3: 93,773,783 L254P probably damaging Het
Gm5916 A T 9: 36,120,716 W91R probably benign Het
Gm8251 T A 1: 44,057,795 Y1381F probably benign Het
Gpam A T 19: 55,088,837 L174H probably damaging Het
Grk1 G A 8: 13,414,478 R450Q probably damaging Het
Hc G A 2: 35,037,624 A326V probably benign Het
Hlcs A G 16: 94,267,524 V426A possibly damaging Het
Ighv1-23 T C 12: 114,764,756 probably benign Het
Itgax G A 7: 128,141,302 V754I probably benign Het
Krt24 T A 11: 99,282,730 D255V probably damaging Het
Lnpk T C 2: 74,573,591 probably benign Het
Loxhd1 G T 18: 77,366,541 R478L probably damaging Het
Lrrc56 A G 7: 141,209,624 Q518R probably benign Het
Mbl1 A T 14: 41,158,829 I225F probably damaging Het
Mmp21 T C 7: 133,675,922 S392G probably benign Het
Mug2 T G 6: 122,081,592 F1318V probably damaging Het
Myo5c A G 9: 75,295,205 N1447S probably null Het
Nbea A C 3: 56,040,876 V543G probably damaging Het
Necap1 A G 6: 122,880,747 I96V probably benign Het
Nr3c2 T A 8: 77,210,748 M872K possibly damaging Het
Nrf1 C T 6: 30,118,968 T362M probably benign Het
Olfr113 T C 17: 37,574,727 E232G probably damaging Het
Plekhm3 T C 1: 64,819,990 E685G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sbk3 A T 7: 4,967,423 S316T probably benign Het
Serpinb9e T C 13: 33,257,784 L233P probably damaging Het
Set T A 2: 30,069,410 S132T possibly damaging Het
Slc17a4 C T 13: 23,908,817 E11K possibly damaging Het
Slc22a6 T A 19: 8,618,553 N86K possibly damaging Het
Slco1a6 A G 6: 142,086,599 L600P probably damaging Het
Sp8 A G 12: 118,848,511 K34E possibly damaging Het
Spen T A 4: 141,471,485 E3254V probably benign Het
Tcf12 G A 9: 71,885,243 P53S probably damaging Het
Tcf3 A G 10: 80,410,211 V626A probably damaging Het
Trpc4ap A G 2: 155,672,988 probably null Het
Ttc3 T A 16: 94,429,620 V892D probably damaging Het
Tub G T 7: 109,026,771 R243L possibly damaging Het
Tubgcp5 A G 7: 55,823,685 Y837C probably damaging Het
Wdhd1 A T 14: 47,268,724 Y244* probably null Het
Xdh T A 17: 73,925,032 T228S probably benign Het
Zfp418 A C 7: 7,182,535 Q499P probably benign Het
Zfpm1 G A 8: 122,335,530 E443K possibly damaging Het
Zfy1 T C Y: 725,950 H605R possibly damaging Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
PIT4466001:Hectd4 UTSW 5 121333060 critical splice donor site probably null
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0115:Hectd4 UTSW 5 121295506 splice site probably benign
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0281:Hectd4 UTSW 5 121254251 missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0410:Hectd4 UTSW 5 121286266 missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 synonymous probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0481:Hectd4 UTSW 5 121295506 splice site probably benign
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121277824 missense probably benign 0.18
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121310599 missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4781:Hectd4 UTSW 5 121306107 critical splice donor site probably null
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 unclassified probably null
R5004:Hectd4 UTSW 5 121329565 missense possibly damaging 0.93
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121310603 missense probably benign 0.04
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121273629 missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121308342 missense probably benign 0.01
R7234:Hectd4 UTSW 5 121329073 missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121314881 missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121310663 missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121281932 missense probably benign 0.00
R7467:Hectd4 UTSW 5 121323961 missense possibly damaging 0.66
R7482:Hectd4 UTSW 5 121363878 missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121297109 missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121343665 missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121315510 splice site probably null
R7560:Hectd4 UTSW 5 121254342 missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121291225 missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121349459 missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121318735 missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121254371 missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121324031 missense probably benign 0.06
R7692:Hectd4 UTSW 5 121321564 missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121220617 missense unknown
R7731:Hectd4 UTSW 5 121307014 missense probably benign 0.00
R7732:Hectd4 UTSW 5 121336629 missense probably benign 0.14
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAACGGTGTTATCTCCCCTG -3'
(R):5'- CACCTAAATACTCGGCTCCTG -3'

Sequencing Primer
(F):5'- ACTCCGAGTCCCTCTCCACTG -3'
(R):5'- GGCTCCTGTCCGTCAAGTAAATAC -3'
Posted On2016-08-04