Incidental Mutation 'R5347:Mug2'
ID 422666
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission 042926-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5347 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 121983720-122062924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 122058551 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 1318 (F1318V)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably damaging
Transcript: ENSMUST00000081777
AA Change: F1318V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: F1318V

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,782,166 (GRCm39) Y233C probably damaging Het
Agl A G 3: 116,584,814 (GRCm39) S169P probably damaging Het
Arid1b C T 17: 5,341,332 (GRCm39) Q879* probably null Het
Bbs2 A G 8: 94,819,178 (GRCm39) S64P probably damaging Het
Bend7 G A 2: 4,768,052 (GRCm39) R336Q probably damaging Het
Cacna2d2 A G 9: 107,391,313 (GRCm39) T447A probably benign Het
Ccdc168 T A 1: 44,096,955 (GRCm39) Y1381F probably benign Het
Ccdc169 A T 3: 55,049,740 (GRCm39) probably benign Het
Cdan1 A G 2: 120,560,546 (GRCm39) S275P possibly damaging Het
Cdh15 A G 8: 123,588,802 (GRCm39) N292S probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cnnm1 A G 19: 43,430,301 (GRCm39) H473R probably benign Het
Cplx4 G A 18: 66,103,157 (GRCm39) probably benign Het
Crb1 C T 1: 139,265,109 (GRCm39) G103E probably damaging Het
Dnaja3 T A 16: 4,512,346 (GRCm39) V250E possibly damaging Het
Dync2h1 T G 9: 7,129,727 (GRCm39) Q1757P probably damaging Het
Edem3 A G 1: 151,683,202 (GRCm39) Q626R probably damaging Het
Eif2b1 T C 5: 124,716,862 (GRCm39) probably benign Het
Esf1 T A 2: 139,996,801 (GRCm39) K521* probably null Het
Fbxl3 A C 14: 103,320,730 (GRCm39) V239G probably damaging Het
Fhip2a A G 19: 57,367,051 (GRCm39) D198G probably benign Het
Fto A G 8: 92,118,107 (GRCm39) probably benign Het
Gm5773 T C 3: 93,681,090 (GRCm39) L254P probably damaging Het
Gm5916 A T 9: 36,032,012 (GRCm39) W91R probably benign Het
Gpam A T 19: 55,077,269 (GRCm39) L174H probably damaging Het
Grk1 G A 8: 13,464,478 (GRCm39) R450Q probably damaging Het
Hc G A 2: 34,927,636 (GRCm39) A326V probably benign Het
Hectd4 T C 5: 121,442,511 (GRCm39) I1317T probably benign Het
Hlcs A G 16: 94,068,383 (GRCm39) V426A possibly damaging Het
Ighv1-23 T C 12: 114,728,376 (GRCm39) probably benign Het
Itgax G A 7: 127,740,474 (GRCm39) V754I probably benign Het
Krt24 T A 11: 99,173,556 (GRCm39) D255V probably damaging Het
Lnpk T C 2: 74,403,935 (GRCm39) probably benign Het
Loxhd1 G T 18: 77,454,237 (GRCm39) R478L probably damaging Het
Lrrc56 A G 7: 140,789,537 (GRCm39) Q518R probably benign Het
Mbl1 A T 14: 40,880,786 (GRCm39) I225F probably damaging Het
Mmp21 T C 7: 133,277,651 (GRCm39) S392G probably benign Het
Myo5c A G 9: 75,202,487 (GRCm39) N1447S probably null Het
Nbea A C 3: 55,948,297 (GRCm39) V543G probably damaging Het
Necap1 A G 6: 122,857,706 (GRCm39) I96V probably benign Het
Nr3c2 T A 8: 77,937,377 (GRCm39) M872K possibly damaging Het
Nrf1 C T 6: 30,118,967 (GRCm39) T362M probably benign Het
Or14j2 T C 17: 37,885,618 (GRCm39) E232G probably damaging Het
Pcare A G 17: 72,056,930 (GRCm39) S916P probably benign Het
Plekhm3 T C 1: 64,859,149 (GRCm39) E685G probably damaging Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Sbk3 A T 7: 4,970,422 (GRCm39) S316T probably benign Het
Serpinb9e T C 13: 33,441,767 (GRCm39) L233P probably damaging Het
Set T A 2: 29,959,422 (GRCm39) S132T possibly damaging Het
Slc17a4 C T 13: 24,092,800 (GRCm39) E11K possibly damaging Het
Slc22a6 T A 19: 8,595,917 (GRCm39) N86K possibly damaging Het
Slco1a6 A G 6: 142,032,325 (GRCm39) L600P probably damaging Het
Sp8 A G 12: 118,812,246 (GRCm39) K34E possibly damaging Het
Spen T A 4: 141,198,796 (GRCm39) E3254V probably benign Het
Tcf12 G A 9: 71,792,525 (GRCm39) P53S probably damaging Het
Tcf3 A G 10: 80,246,045 (GRCm39) V626A probably damaging Het
Trpc4ap A G 2: 155,514,908 (GRCm39) probably null Het
Ttc3 T A 16: 94,230,479 (GRCm39) V892D probably damaging Het
Tub G T 7: 108,625,978 (GRCm39) R243L possibly damaging Het
Tubgcp5 A G 7: 55,473,433 (GRCm39) Y837C probably damaging Het
Utp25 A T 1: 192,810,687 (GRCm39) D105E probably benign Het
Wdhd1 A T 14: 47,506,181 (GRCm39) Y244* probably null Het
Xdh T A 17: 74,232,027 (GRCm39) T228S probably benign Het
Zfp418 A C 7: 7,185,534 (GRCm39) Q499P probably benign Het
Zfpm1 G A 8: 123,062,269 (GRCm39) E443K possibly damaging Het
Zfy1 T C Y: 725,950 (GRCm39) H605R possibly damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122,024,446 (GRCm39) missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122,017,613 (GRCm39) missense probably damaging 0.99
IGL01314:Mug2 APN 6 122,058,238 (GRCm39) missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122,026,587 (GRCm39) splice site probably benign
IGL01477:Mug2 APN 6 122,058,643 (GRCm39) splice site probably benign
IGL01926:Mug2 APN 6 122,013,063 (GRCm39) splice site probably benign
IGL02019:Mug2 APN 6 122,024,394 (GRCm39) missense probably benign 0.02
IGL02305:Mug2 APN 6 122,013,015 (GRCm39) missense probably benign
IGL02310:Mug2 APN 6 122,036,082 (GRCm39) splice site probably benign
IGL02484:Mug2 APN 6 122,049,712 (GRCm39) missense probably damaging 1.00
IGL02516:Mug2 APN 6 122,047,802 (GRCm39) missense probably damaging 1.00
IGL02531:Mug2 APN 6 122,049,730 (GRCm39) missense probably damaging 1.00
IGL02666:Mug2 APN 6 122,058,285 (GRCm39) missense probably damaging 1.00
IGL02936:Mug2 APN 6 122,058,346 (GRCm39) critical splice donor site probably null
R0114:Mug2 UTSW 6 122,017,607 (GRCm39) missense probably damaging 1.00
R0119:Mug2 UTSW 6 122,013,022 (GRCm39) missense probably benign 0.00
R0123:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122,047,970 (GRCm39) splice site probably benign
R0225:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122,058,558 (GRCm39) missense probably damaging 1.00
R0763:Mug2 UTSW 6 122,052,253 (GRCm39) missense probably benign
R0959:Mug2 UTSW 6 122,062,454 (GRCm39) missense probably benign 0.33
R1104:Mug2 UTSW 6 122,036,014 (GRCm39) missense probably benign
R1239:Mug2 UTSW 6 122,058,637 (GRCm39) splice site probably benign
R1318:Mug2 UTSW 6 122,054,361 (GRCm39) missense probably damaging 1.00
R1460:Mug2 UTSW 6 122,017,492 (GRCm39) splice site probably benign
R1706:Mug2 UTSW 6 122,013,191 (GRCm39) splice site probably benign
R1761:Mug2 UTSW 6 122,051,664 (GRCm39) missense probably benign 0.20
R1901:Mug2 UTSW 6 122,048,801 (GRCm39) missense probably benign 0.02
R1913:Mug2 UTSW 6 122,047,829 (GRCm39) missense probably damaging 1.00
R1943:Mug2 UTSW 6 122,056,598 (GRCm39) missense probably benign
R2054:Mug2 UTSW 6 122,054,451 (GRCm39) missense probably damaging 1.00
R2060:Mug2 UTSW 6 122,056,571 (GRCm39) missense probably benign
R2420:Mug2 UTSW 6 122,060,419 (GRCm39) missense probably damaging 1.00
R2432:Mug2 UTSW 6 122,061,335 (GRCm39) missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R2918:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R3423:Mug2 UTSW 6 122,024,465 (GRCm39) splice site probably benign
R3834:Mug2 UTSW 6 122,026,746 (GRCm39) critical splice donor site probably null
R3902:Mug2 UTSW 6 122,052,526 (GRCm39) missense probably damaging 1.00
R3941:Mug2 UTSW 6 122,040,522 (GRCm39) missense probably benign
R4227:Mug2 UTSW 6 122,017,691 (GRCm39) missense probably benign 0.10
R4284:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4287:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4377:Mug2 UTSW 6 122,047,966 (GRCm39) critical splice donor site probably null
R4419:Mug2 UTSW 6 122,056,589 (GRCm39) missense probably damaging 1.00
R4498:Mug2 UTSW 6 122,059,711 (GRCm39) missense probably damaging 0.99
R4566:Mug2 UTSW 6 122,056,597 (GRCm39) missense probably benign 0.00
R4690:Mug2 UTSW 6 122,013,255 (GRCm39) missense probably benign
R4732:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4733:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4741:Mug2 UTSW 6 122,056,572 (GRCm39) missense probably benign
R4888:Mug2 UTSW 6 122,058,154 (GRCm39) missense probably damaging 1.00
R5199:Mug2 UTSW 6 122,017,619 (GRCm39) missense probably benign
R5457:Mug2 UTSW 6 122,026,688 (GRCm39) nonsense probably null
R5495:Mug2 UTSW 6 122,056,609 (GRCm39) missense probably damaging 0.96
R5509:Mug2 UTSW 6 122,061,340 (GRCm39) missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122,060,459 (GRCm39) missense probably null 0.98
R6180:Mug2 UTSW 6 122,056,565 (GRCm39) missense probably benign 0.01
R6184:Mug2 UTSW 6 122,014,005 (GRCm39) missense probably benign
R6199:Mug2 UTSW 6 122,024,398 (GRCm39) missense probably benign 0.05
R6262:Mug2 UTSW 6 122,052,214 (GRCm39) missense probably damaging 1.00
R6416:Mug2 UTSW 6 122,059,713 (GRCm39) missense probably damaging 1.00
R6548:Mug2 UTSW 6 122,024,401 (GRCm39) missense probably damaging 1.00
R6703:Mug2 UTSW 6 122,055,653 (GRCm39) missense probably benign 0.25
R7106:Mug2 UTSW 6 122,059,680 (GRCm39) missense probably damaging 1.00
R7131:Mug2 UTSW 6 122,052,206 (GRCm39) missense probably damaging 1.00
R7372:Mug2 UTSW 6 122,060,425 (GRCm39) missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122,024,446 (GRCm39) missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122,017,529 (GRCm39) missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122,056,685 (GRCm39) missense probably benign 0.00
R7581:Mug2 UTSW 6 122,040,670 (GRCm39) missense probably damaging 1.00
R7582:Mug2 UTSW 6 122,056,603 (GRCm39) missense probably damaging 0.99
R7672:Mug2 UTSW 6 122,017,678 (GRCm39) missense probably benign 0.37
R7713:Mug2 UTSW 6 122,055,754 (GRCm39) missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122,058,317 (GRCm39) missense probably damaging 1.00
R7834:Mug2 UTSW 6 122,013,241 (GRCm39) missense probably benign
R7850:Mug2 UTSW 6 122,052,170 (GRCm39) missense probably damaging 1.00
R8029:Mug2 UTSW 6 122,058,504 (GRCm39) critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122,052,567 (GRCm39) missense probably benign 0.01
R8335:Mug2 UTSW 6 122,017,543 (GRCm39) missense probably benign
R8348:Mug2 UTSW 6 122,049,192 (GRCm39) nonsense probably null
R8557:Mug2 UTSW 6 122,040,660 (GRCm39) missense probably damaging 0.99
R8798:Mug2 UTSW 6 122,058,569 (GRCm39) missense probably damaging 1.00
R8823:Mug2 UTSW 6 122,040,648 (GRCm39) missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122,061,328 (GRCm39) missense probably damaging 1.00
R9153:Mug2 UTSW 6 122,017,627 (GRCm39) missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122,054,442 (GRCm39) missense probably benign 0.06
R9186:Mug2 UTSW 6 122,052,248 (GRCm39) missense probably damaging 0.99
R9418:Mug2 UTSW 6 122,017,700 (GRCm39) missense probably benign 0.00
R9464:Mug2 UTSW 6 122,028,690 (GRCm39) missense probably benign 0.01
R9622:Mug2 UTSW 6 122,028,751 (GRCm39) missense probably benign 0.29
Z1177:Mug2 UTSW 6 122,014,080 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCTTCTTCCCCAAAATGG -3'
(R):5'- GAAGACAGCCTGATAGTAGCTG -3'

Sequencing Primer
(F):5'- CTTCTTCCCCAAAATGGAAAGTCTG -3'
(R):5'- TCATACAGGGACAAGACAGATTCTC -3'
Posted On 2016-08-04