Incidental Mutation 'R5347:Mmp21'
ID422675
Institutional Source Beutler Lab
Gene Symbol Mmp21
Ensembl Gene ENSMUSG00000030981
Gene Namematrix metallopeptidase 21
Synonyms
MMRRC Submission 042926-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5347 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location133674270-133680061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133675922 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 392 (S392G)
Ref Sequence ENSEMBL: ENSMUSP00000113853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033278] [ENSMUST00000051169] [ENSMUST00000122136] [ENSMUST00000128901]
Predicted Effect probably benign
Transcript: ENSMUST00000033278
AA Change: S392G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033278
Gene: ENSMUSG00000030981
AA Change: S392G

DomainStartEndE-ValueType
Pfam:PG_binding_1 46 107 5.6e-13 PFAM
low complexity region 117 133 N/A INTRINSIC
ZnMc 166 327 2.67e-32 SMART
HX 332 390 1.97e-1 SMART
HX 393 448 5.36e-6 SMART
HX 450 497 9.33e-6 SMART
HX 505 548 1.11e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051169
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122136
AA Change: S392G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113853
Gene: ENSMUSG00000030981
AA Change: S392G

DomainStartEndE-ValueType
Pfam:PG_binding_1 46 107 1.9e-13 PFAM
low complexity region 117 133 N/A INTRINSIC
ZnMc 166 327 2.67e-32 SMART
Pfam:Hemopexin 351 390 4.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128901
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137338
Predicted Effect probably benign
Transcript: ENSMUST00000176661
SMART Domains Protein: ENSMUSP00000134967
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 116 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211072
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. Mice harboring certain mutations in this gene exhibit congenital heart defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit heterotaxia and congenital cardiovascular defects including d-loop transposition of the great arteries, tricupid valve atresia, and ventricular septal defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,892,154 Y233C probably damaging Het
Agl A G 3: 116,791,165 S169P probably damaging Het
Arid1b C T 17: 5,291,057 Q879* probably null Het
Bbs2 A G 8: 94,092,550 S64P probably damaging Het
BC027072 A G 17: 71,749,935 S916P probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Cacna2d2 A G 9: 107,514,114 T447A probably benign Het
Ccdc169 A T 3: 55,142,319 probably benign Het
Cdan1 A G 2: 120,730,065 S275P possibly damaging Het
Cdh15 A G 8: 122,862,063 N292S probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnnm1 A G 19: 43,441,862 H473R probably benign Het
Cplx4 G A 18: 65,970,086 probably benign Het
Crb1 C T 1: 139,337,371 G103E probably damaging Het
Diexf A T 1: 193,128,379 D105E probably benign Het
Dnaja3 T A 16: 4,694,482 V250E possibly damaging Het
Dync2h1 T G 9: 7,129,727 Q1757P probably damaging Het
Edem3 A G 1: 151,807,451 Q626R probably damaging Het
Eif2b1 T C 5: 124,578,799 probably benign Het
Esf1 T A 2: 140,154,881 K521* probably null Het
Fam160b1 A G 19: 57,378,619 D198G probably benign Het
Fbxl3 A C 14: 103,083,294 V239G probably damaging Het
Fto A G 8: 91,391,479 probably benign Het
Gm5773 T C 3: 93,773,783 L254P probably damaging Het
Gm5916 A T 9: 36,120,716 W91R probably benign Het
Gm8251 T A 1: 44,057,795 Y1381F probably benign Het
Gpam A T 19: 55,088,837 L174H probably damaging Het
Grk1 G A 8: 13,414,478 R450Q probably damaging Het
Hc G A 2: 35,037,624 A326V probably benign Het
Hectd4 T C 5: 121,304,448 I1317T probably benign Het
Hlcs A G 16: 94,267,524 V426A possibly damaging Het
Ighv1-23 T C 12: 114,764,756 probably benign Het
Itgax G A 7: 128,141,302 V754I probably benign Het
Krt24 T A 11: 99,282,730 D255V probably damaging Het
Lnpk T C 2: 74,573,591 probably benign Het
Loxhd1 G T 18: 77,366,541 R478L probably damaging Het
Lrrc56 A G 7: 141,209,624 Q518R probably benign Het
Mbl1 A T 14: 41,158,829 I225F probably damaging Het
Mug2 T G 6: 122,081,592 F1318V probably damaging Het
Myo5c A G 9: 75,295,205 N1447S probably null Het
Nbea A C 3: 56,040,876 V543G probably damaging Het
Necap1 A G 6: 122,880,747 I96V probably benign Het
Nr3c2 T A 8: 77,210,748 M872K possibly damaging Het
Nrf1 C T 6: 30,118,968 T362M probably benign Het
Olfr113 T C 17: 37,574,727 E232G probably damaging Het
Plekhm3 T C 1: 64,819,990 E685G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sbk3 A T 7: 4,967,423 S316T probably benign Het
Serpinb9e T C 13: 33,257,784 L233P probably damaging Het
Set T A 2: 30,069,410 S132T possibly damaging Het
Slc17a4 C T 13: 23,908,817 E11K possibly damaging Het
Slc22a6 T A 19: 8,618,553 N86K possibly damaging Het
Slco1a6 A G 6: 142,086,599 L600P probably damaging Het
Sp8 A G 12: 118,848,511 K34E possibly damaging Het
Spen T A 4: 141,471,485 E3254V probably benign Het
Tcf12 G A 9: 71,885,243 P53S probably damaging Het
Tcf3 A G 10: 80,410,211 V626A probably damaging Het
Trpc4ap A G 2: 155,672,988 probably null Het
Ttc3 T A 16: 94,429,620 V892D probably damaging Het
Tub G T 7: 109,026,771 R243L possibly damaging Het
Tubgcp5 A G 7: 55,823,685 Y837C probably damaging Het
Wdhd1 A T 14: 47,268,724 Y244* probably null Het
Xdh T A 17: 73,925,032 T228S probably benign Het
Zfp418 A C 7: 7,182,535 Q499P probably benign Het
Zfpm1 G A 8: 122,335,530 E443K possibly damaging Het
Zfy1 T C Y: 725,950 H605R possibly damaging Het
Other mutations in Mmp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Mmp21 APN 7 133675914 missense probably damaging 1.00
IGL02822:Mmp21 APN 7 133676099 missense possibly damaging 0.80
IGL03240:Mmp21 APN 7 133674571 missense probably damaging 0.97
IGL03261:Mmp21 APN 7 133674674 missense probably benign 0.01
R0659:Mmp21 UTSW 7 133677667 splice site probably benign
R1037:Mmp21 UTSW 7 133674453 missense probably benign 0.16
R1463:Mmp21 UTSW 7 133675859 splice site probably null
R1523:Mmp21 UTSW 7 133679045 missense probably benign
R1710:Mmp21 UTSW 7 133677285 missense probably damaging 1.00
R1804:Mmp21 UTSW 7 133678882 missense probably benign 0.01
R1848:Mmp21 UTSW 7 133677153 missense probably benign 0.05
R2993:Mmp21 UTSW 7 133678986 missense probably damaging 1.00
R3431:Mmp21 UTSW 7 133678750 missense probably benign 0.00
R4790:Mmp21 UTSW 7 133675030 missense probably damaging 1.00
R4870:Mmp21 UTSW 7 133678677 missense probably damaging 1.00
R5134:Mmp21 UTSW 7 133679013 missense probably benign 0.00
R5682:Mmp21 UTSW 7 133674629 missense probably benign 0.00
R5905:Mmp21 UTSW 7 133678714 missense probably benign 0.17
R6028:Mmp21 UTSW 7 133678714 missense probably benign 0.17
R6936:Mmp21 UTSW 7 133678975 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTATCCTTCCTAAGATCGGG -3'
(R):5'- AGTGTTTGACTGGATCCGC -3'

Sequencing Primer
(F):5'- TATCCTTCCTAAGATCGGGGGACAC -3'
(R):5'- CGCAAGGAGAGGAACCAATATG -3'
Posted On2016-08-04