Incidental Mutation 'R5347:Grk1'
ID422677
Institutional Source Beutler Lab
Gene Symbol Grk1
Ensembl Gene ENSMUSG00000031450
Gene NameG protein-coupled receptor kinase 1
SynonymsRK, Rhok
MMRRC Submission 042926-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5347 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13405081-13421951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13414478 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 450 (R450Q)
Ref Sequence ENSEMBL: ENSMUSP00000147484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033827] [ENSMUST00000209909]
Predicted Effect probably damaging
Transcript: ENSMUST00000033827
AA Change: R450Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033827
Gene: ENSMUSG00000031450
AA Change: R450Q

DomainStartEndE-ValueType
RGS 57 175 7.34e-35 SMART
S_TKc 190 455 3.42e-81 SMART
S_TK_X 456 535 3.21e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209909
AA Change: R450Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211027
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates rhodopsin and initiates its deactivation. Defects in GRK1 are known to cause Oguchi disease 2 (also known as stationary night blindness Oguchi type-2). [provided by RefSeq, Jul 2008]
PHENOTYPE: Analysis of homozygous null mice revealed abnormal photoresponses and light-induced apoptosis in rods. Mutant mice may serve as models of Oguchi disease and retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,892,154 Y233C probably damaging Het
Agl A G 3: 116,791,165 S169P probably damaging Het
Arid1b C T 17: 5,291,057 Q879* probably null Het
Bbs2 A G 8: 94,092,550 S64P probably damaging Het
BC027072 A G 17: 71,749,935 S916P probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Cacna2d2 A G 9: 107,514,114 T447A probably benign Het
Ccdc169 A T 3: 55,142,319 probably benign Het
Cdan1 A G 2: 120,730,065 S275P possibly damaging Het
Cdh15 A G 8: 122,862,063 N292S probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnnm1 A G 19: 43,441,862 H473R probably benign Het
Cplx4 G A 18: 65,970,086 probably benign Het
Crb1 C T 1: 139,337,371 G103E probably damaging Het
Diexf A T 1: 193,128,379 D105E probably benign Het
Dnaja3 T A 16: 4,694,482 V250E possibly damaging Het
Dync2h1 T G 9: 7,129,727 Q1757P probably damaging Het
Edem3 A G 1: 151,807,451 Q626R probably damaging Het
Eif2b1 T C 5: 124,578,799 probably benign Het
Esf1 T A 2: 140,154,881 K521* probably null Het
Fam160b1 A G 19: 57,378,619 D198G probably benign Het
Fbxl3 A C 14: 103,083,294 V239G probably damaging Het
Fto A G 8: 91,391,479 probably benign Het
Gm5773 T C 3: 93,773,783 L254P probably damaging Het
Gm5916 A T 9: 36,120,716 W91R probably benign Het
Gm8251 T A 1: 44,057,795 Y1381F probably benign Het
Gpam A T 19: 55,088,837 L174H probably damaging Het
Hc G A 2: 35,037,624 A326V probably benign Het
Hectd4 T C 5: 121,304,448 I1317T probably benign Het
Hlcs A G 16: 94,267,524 V426A possibly damaging Het
Ighv1-23 T C 12: 114,764,756 probably benign Het
Itgax G A 7: 128,141,302 V754I probably benign Het
Krt24 T A 11: 99,282,730 D255V probably damaging Het
Lnpk T C 2: 74,573,591 probably benign Het
Loxhd1 G T 18: 77,366,541 R478L probably damaging Het
Lrrc56 A G 7: 141,209,624 Q518R probably benign Het
Mbl1 A T 14: 41,158,829 I225F probably damaging Het
Mmp21 T C 7: 133,675,922 S392G probably benign Het
Mug2 T G 6: 122,081,592 F1318V probably damaging Het
Myo5c A G 9: 75,295,205 N1447S probably null Het
Nbea A C 3: 56,040,876 V543G probably damaging Het
Necap1 A G 6: 122,880,747 I96V probably benign Het
Nr3c2 T A 8: 77,210,748 M872K possibly damaging Het
Nrf1 C T 6: 30,118,968 T362M probably benign Het
Olfr113 T C 17: 37,574,727 E232G probably damaging Het
Plekhm3 T C 1: 64,819,990 E685G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sbk3 A T 7: 4,967,423 S316T probably benign Het
Serpinb9e T C 13: 33,257,784 L233P probably damaging Het
Set T A 2: 30,069,410 S132T possibly damaging Het
Slc17a4 C T 13: 23,908,817 E11K possibly damaging Het
Slc22a6 T A 19: 8,618,553 N86K possibly damaging Het
Slco1a6 A G 6: 142,086,599 L600P probably damaging Het
Sp8 A G 12: 118,848,511 K34E possibly damaging Het
Spen T A 4: 141,471,485 E3254V probably benign Het
Tcf12 G A 9: 71,885,243 P53S probably damaging Het
Tcf3 A G 10: 80,410,211 V626A probably damaging Het
Trpc4ap A G 2: 155,672,988 probably null Het
Ttc3 T A 16: 94,429,620 V892D probably damaging Het
Tub G T 7: 109,026,771 R243L possibly damaging Het
Tubgcp5 A G 7: 55,823,685 Y837C probably damaging Het
Wdhd1 A T 14: 47,268,724 Y244* probably null Het
Xdh T A 17: 73,925,032 T228S probably benign Het
Zfp418 A C 7: 7,182,535 Q499P probably benign Het
Zfpm1 G A 8: 122,335,530 E443K possibly damaging Het
Zfy1 T C Y: 725,950 H605R possibly damaging Het
Other mutations in Grk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Grk1 APN 8 13413128 nonsense probably null
IGL00501:Grk1 APN 8 13407835 missense probably damaging 1.00
IGL00772:Grk1 APN 8 13405349 missense probably benign
IGL00905:Grk1 APN 8 13416068 missense probably benign 0.32
IGL01116:Grk1 APN 8 13405404 missense possibly damaging 0.52
IGL01976:Grk1 APN 8 13415993 missense probably damaging 1.00
R0463:Grk1 UTSW 8 13409279 missense probably damaging 1.00
R1600:Grk1 UTSW 8 13405406 missense probably benign 0.01
R1838:Grk1 UTSW 8 13416155 missense possibly damaging 0.77
R1911:Grk1 UTSW 8 13407923 missense probably damaging 0.99
R2122:Grk1 UTSW 8 13405221 missense probably benign 0.01
R4583:Grk1 UTSW 8 13409322 missense probably damaging 0.99
R5520:Grk1 UTSW 8 13409305 missense probably benign
R5682:Grk1 UTSW 8 13414351 missense possibly damaging 0.88
R6145:Grk1 UTSW 8 13405765 nonsense probably null
R6329:Grk1 UTSW 8 13405704 missense probably damaging 1.00
R6415:Grk1 UTSW 8 13413127 missense probably damaging 1.00
R6717:Grk1 UTSW 8 13416237 missense probably benign 0.01
R7421:Grk1 UTSW 8 13405316 missense probably damaging 1.00
R8401:Grk1 UTSW 8 13407846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAAGTCCTAAGGCTTGAGG -3'
(R):5'- TGAAGCAGGCTCAGAGCTTC -3'

Sequencing Primer
(F):5'- CAAGTGAAGTGGTGCATTTACCTACC -3'
(R):5'- GGCTCAGAGCTTCCACACTAG -3'
Posted On2016-08-04