Incidental Mutation 'R5347:Fto'
ID422679
Institutional Source Beutler Lab
Gene Symbol Fto
Ensembl Gene ENSMUSG00000055932
Gene Namefat mass and obesity associated
Synonyms
MMRRC Submission 042926-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5347 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location91313525-91668439 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 91391479 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069718] [ENSMUST00000125471] [ENSMUST00000128081] [ENSMUST00000136802] [ENSMUST00000149913] [ENSMUST00000166548]
Predicted Effect probably benign
Transcript: ENSMUST00000069718
SMART Domains Protein: ENSMUSP00000068380
Gene: ENSMUSG00000055932

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
FTO_NTD 35 323 2.71e-191 SMART
Pfam:FTO_CTD 326 495 1.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125471
Predicted Effect probably benign
Transcript: ENSMUST00000128081
Predicted Effect probably benign
Transcript: ENSMUST00000136802
Predicted Effect unknown
Transcript: ENSMUST00000149913
AA Change: T20A
SMART Domains Protein: ENSMUSP00000123142
Gene: ENSMUSG00000055932
AA Change: T20A

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Pfam:FTO_NTD 63 150 3.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166548
SMART Domains Protein: ENSMUSP00000127680
Gene: ENSMUSG00000055932

DomainStartEndE-ValueType
FTO_NTD 33 245 2.23e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209572
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a nuclear protein of the AlkB related non-haem iron and 2-oxoglutarate-dependent oxygenase superfamily but the exact physiological function of this gene is not known. Other non-heme iron enzymes function to reverse alkylated DNA and RNA damage by oxidative demethylation. Studies in mice and humans indicate a role in nervous and cardiovascular systems and a strong association with body mass index, obesity risk, and type 2 diabetes. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted knock-out allele exhibit decreased body weight, adipose tissue, and body fat and increased metabolism, serum lipids, and serum glucagon that may be gender and diet dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,892,154 Y233C probably damaging Het
Agl A G 3: 116,791,165 S169P probably damaging Het
Arid1b C T 17: 5,291,057 Q879* probably null Het
Bbs2 A G 8: 94,092,550 S64P probably damaging Het
BC027072 A G 17: 71,749,935 S916P probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Cacna2d2 A G 9: 107,514,114 T447A probably benign Het
Ccdc169 A T 3: 55,142,319 probably benign Het
Cdan1 A G 2: 120,730,065 S275P possibly damaging Het
Cdh15 A G 8: 122,862,063 N292S probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnnm1 A G 19: 43,441,862 H473R probably benign Het
Cplx4 G A 18: 65,970,086 probably benign Het
Crb1 C T 1: 139,337,371 G103E probably damaging Het
Diexf A T 1: 193,128,379 D105E probably benign Het
Dnaja3 T A 16: 4,694,482 V250E possibly damaging Het
Dync2h1 T G 9: 7,129,727 Q1757P probably damaging Het
Edem3 A G 1: 151,807,451 Q626R probably damaging Het
Eif2b1 T C 5: 124,578,799 probably benign Het
Esf1 T A 2: 140,154,881 K521* probably null Het
Fam160b1 A G 19: 57,378,619 D198G probably benign Het
Fbxl3 A C 14: 103,083,294 V239G probably damaging Het
Gm5773 T C 3: 93,773,783 L254P probably damaging Het
Gm5916 A T 9: 36,120,716 W91R probably benign Het
Gm8251 T A 1: 44,057,795 Y1381F probably benign Het
Gpam A T 19: 55,088,837 L174H probably damaging Het
Grk1 G A 8: 13,414,478 R450Q probably damaging Het
Hc G A 2: 35,037,624 A326V probably benign Het
Hectd4 T C 5: 121,304,448 I1317T probably benign Het
Hlcs A G 16: 94,267,524 V426A possibly damaging Het
Ighv1-23 T C 12: 114,764,756 probably benign Het
Itgax G A 7: 128,141,302 V754I probably benign Het
Krt24 T A 11: 99,282,730 D255V probably damaging Het
Lnpk T C 2: 74,573,591 probably benign Het
Loxhd1 G T 18: 77,366,541 R478L probably damaging Het
Lrrc56 A G 7: 141,209,624 Q518R probably benign Het
Mbl1 A T 14: 41,158,829 I225F probably damaging Het
Mmp21 T C 7: 133,675,922 S392G probably benign Het
Mug2 T G 6: 122,081,592 F1318V probably damaging Het
Myo5c A G 9: 75,295,205 N1447S probably null Het
Nbea A C 3: 56,040,876 V543G probably damaging Het
Necap1 A G 6: 122,880,747 I96V probably benign Het
Nr3c2 T A 8: 77,210,748 M872K possibly damaging Het
Nrf1 C T 6: 30,118,968 T362M probably benign Het
Olfr113 T C 17: 37,574,727 E232G probably damaging Het
Plekhm3 T C 1: 64,819,990 E685G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sbk3 A T 7: 4,967,423 S316T probably benign Het
Serpinb9e T C 13: 33,257,784 L233P probably damaging Het
Set T A 2: 30,069,410 S132T possibly damaging Het
Slc17a4 C T 13: 23,908,817 E11K possibly damaging Het
Slc22a6 T A 19: 8,618,553 N86K possibly damaging Het
Slco1a6 A G 6: 142,086,599 L600P probably damaging Het
Sp8 A G 12: 118,848,511 K34E possibly damaging Het
Spen T A 4: 141,471,485 E3254V probably benign Het
Tcf12 G A 9: 71,885,243 P53S probably damaging Het
Tcf3 A G 10: 80,410,211 V626A probably damaging Het
Trpc4ap A G 2: 155,672,988 probably null Het
Ttc3 T A 16: 94,429,620 V892D probably damaging Het
Tub G T 7: 109,026,771 R243L possibly damaging Het
Tubgcp5 A G 7: 55,823,685 Y837C probably damaging Het
Wdhd1 A T 14: 47,268,724 Y244* probably null Het
Xdh T A 17: 73,925,032 T228S probably benign Het
Zfp418 A C 7: 7,182,535 Q499P probably benign Het
Zfpm1 G A 8: 122,335,530 E443K possibly damaging Het
Zfy1 T C Y: 725,950 H605R possibly damaging Het
Other mutations in Fto
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Fto APN 8 91441716 missense probably benign 0.29
IGL01541:Fto APN 8 91409748 missense probably damaging 1.00
IGL01636:Fto APN 8 91409341 missense probably damaging 1.00
IGL01788:Fto APN 8 91409731 missense probably benign 0.25
IGL02016:Fto APN 8 91666406 nonsense probably null
IGL02365:Fto APN 8 91468375 missense probably damaging 1.00
IGL02639:Fto APN 8 91409528 missense probably damaging 1.00
IGL02926:Fto APN 8 91485167 missense probably damaging 1.00
IGL03194:Fto APN 8 91409787 missense probably damaging 1.00
R0091:Fto UTSW 8 91441807 critical splice donor site probably null
R0105:Fto UTSW 8 91522802 missense probably damaging 1.00
R0326:Fto UTSW 8 91409527 missense probably damaging 1.00
R0332:Fto UTSW 8 91401890 splice site probably benign
R0378:Fto UTSW 8 91474312 missense probably damaging 1.00
R0601:Fto UTSW 8 91401802 splice site probably null
R1526:Fto UTSW 8 91441686 missense possibly damaging 0.90
R2092:Fto UTSW 8 91409687 nonsense probably null
R4731:Fto UTSW 8 91409714 missense probably damaging 1.00
R4732:Fto UTSW 8 91409714 missense probably damaging 1.00
R4733:Fto UTSW 8 91409714 missense probably damaging 1.00
R5840:Fto UTSW 8 91666440 utr 3 prime probably benign
R7213:Fto UTSW 8 91391507 missense probably benign 0.00
R7271:Fto UTSW 8 91485190 missense probably damaging 1.00
R7658:Fto UTSW 8 91666322 missense probably benign 0.34
R7763:Fto UTSW 8 91409443 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGACTGCAGGGTTGTGTCC -3'
(R):5'- AACTTAGGTGTCTGCACTTCC -3'

Sequencing Primer
(F):5'- GGTTGTGTCCCTAGCAAAATAGAC -3'
(R):5'- CGGGCTACATATTCTATAAATGTTGG -3'
Posted On2016-08-04