Incidental Mutation 'R0486:Arhgef11'
ID42268
Institutional Source Beutler Lab
Gene Symbol Arhgef11
Ensembl Gene ENSMUSG00000041977
Gene NameRho guanine nucleotide exchange factor (GEF) 11
SynonymsPrg, PDZ-RhoGEF
MMRRC Submission 038685-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0486 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87617559-87738034 bp(+) (GRCm38)
Type of Mutationunclassified (2 bp from exon)
DNA Base Change (assembly) T to A at 87688852 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000129113] [ENSMUST00000152006] [ENSMUST00000212015]
Predicted Effect probably null
Transcript: ENSMUST00000039476
SMART Domains Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
RhoGEF 768 952 1.11e-65 SMART
PH 996 1111 9.49e-6 SMART
low complexity region 1153 1166 N/A INTRINSIC
low complexity region 1176 1188 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1357 1367 N/A INTRINSIC
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129113
SMART Domains Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
RGS 313 432 3.36e-11 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 652 665 N/A INTRINSIC
RhoGEF 739 923 1.11e-65 SMART
PH 967 1082 9.49e-6 SMART
low complexity region 1124 1137 N/A INTRINSIC
low complexity region 1147 1159 N/A INTRINSIC
low complexity region 1304 1314 N/A INTRINSIC
low complexity region 1328 1338 N/A INTRINSIC
low complexity region 1449 1461 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129113
SMART Domains Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
RGS 313 432 3.36e-11 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 652 665 N/A INTRINSIC
RhoGEF 739 923 1.11e-65 SMART
PH 967 1082 9.49e-6 SMART
low complexity region 1124 1137 N/A INTRINSIC
low complexity region 1147 1159 N/A INTRINSIC
low complexity region 1304 1314 N/A INTRINSIC
low complexity region 1328 1338 N/A INTRINSIC
low complexity region 1449 1461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142799
Predicted Effect probably benign
Transcript: ENSMUST00000152006
SMART Domains Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212015
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 T C 4: 40,177,783 L268P probably damaging Het
Adam22 A T 5: 8,330,048 H83Q probably damaging Het
Anln T C 9: 22,352,826 D886G probably benign Het
Arl8b A T 6: 108,815,326 D116V possibly damaging Het
BC051665 C T 13: 60,784,045 G180D probably damaging Het
Bloc1s2 A G 19: 44,143,150 probably benign Het
Ccdc185 T G 1: 182,747,859 S422R possibly damaging Het
Cd101 T C 3: 101,008,092 K720E possibly damaging Het
Cdh23 C A 10: 60,386,946 A1236S probably damaging Het
Chd1 G A 17: 15,734,342 A491T probably damaging Het
Chdh T C 14: 30,032,858 V275A possibly damaging Het
Cmtm2b A T 8: 104,330,415 I136F probably damaging Het
Cps1 T C 1: 67,165,392 V457A probably damaging Het
Cwf19l1 A G 19: 44,114,690 V362A probably benign Het
Cyp4f17 T C 17: 32,524,823 probably benign Het
Cyp4f18 C A 8: 71,996,017 V263L probably benign Het
Dclre1a A G 19: 56,541,490 probably benign Het
Dpp6 T C 5: 27,661,642 I446T probably benign Het
F11r T C 1: 171,460,588 W61R probably damaging Het
Fam120b C T 17: 15,426,288 probably benign Het
Fastkd2 T C 1: 63,752,340 V669A possibly damaging Het
Foxg1 T C 12: 49,384,531 probably benign Het
Foxo3 A G 10: 42,197,481 Y347H probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gbp7 C A 3: 142,546,317 probably benign Het
Glipr1 T C 10: 111,996,849 probably benign Het
Gm11555 A G 11: 99,650,160 S8P unknown Het
H6pd G A 4: 149,982,936 probably benign Het
Haus8 C A 8: 71,256,537 G76W probably damaging Het
Haus8 C T 8: 71,256,538 M75I probably benign Het
Kcnj13 C A 1: 87,387,030 V157L probably damaging Het
Kcnt2 T A 1: 140,509,480 C550* probably null Het
Kdm5d A G Y: 927,107 N615S probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Ngef T A 1: 87,479,126 N640I probably damaging Het
Nhlrc3 T C 3: 53,452,437 Y335C probably damaging Het
Nipbl A T 15: 8,338,870 probably benign Het
Nop2 A G 6: 125,140,673 K434R probably null Het
Nr4a3 T C 4: 48,056,525 probably benign Het
Olfr881 A G 9: 37,992,702 N70S possibly damaging Het
Piezo2 A C 18: 63,029,061 I2233R probably damaging Het
Prag1 A T 8: 36,146,633 E1113V probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Psmd1 T A 1: 86,094,290 N611K probably damaging Het
Ptpn7 C T 1: 135,137,358 T168I probably damaging Het
Pus1 A T 5: 110,779,730 V53E probably damaging Het
Rgs22 A G 15: 36,092,882 M415T probably damaging Het
Rnf165 T A 18: 77,484,254 Q91L probably damaging Het
Rnf17 C T 14: 56,514,175 T1490M probably benign Het
Rnf20 C A 4: 49,645,907 L332I possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spam1 A T 6: 24,796,395 Q115L probably damaging Het
Syce1l A T 8: 113,654,763 probably null Het
Synj1 T C 16: 90,938,263 probably benign Het
Tas2r126 A T 6: 42,435,291 I253F probably benign Het
Tecpr2 G A 12: 110,896,369 V72I probably benign Het
Tfap2a G T 13: 40,728,694 P45Q probably damaging Het
Trip12 C A 1: 84,761,084 G714* probably null Het
Wdr31 A G 4: 62,453,893 S330P probably damaging Het
Wdr64 T C 1: 175,795,203 probably benign Het
Yes1 T A 5: 32,655,582 Y343* probably null Het
Other mutations in Arhgef11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Arhgef11 APN 3 87729503 missense probably damaging 1.00
IGL00900:Arhgef11 APN 3 87683560 missense possibly damaging 0.71
IGL01291:Arhgef11 APN 3 87733174 missense probably benign 0.00
IGL01475:Arhgef11 APN 3 87727126 splice site probably benign
IGL01599:Arhgef11 APN 3 87737046 missense probably benign
IGL02251:Arhgef11 APN 3 87683547 missense probably damaging 1.00
IGL02651:Arhgef11 APN 3 87698864 missense probably damaging 0.99
IGL02884:Arhgef11 APN 3 87728006 missense probably damaging 1.00
IGL02900:Arhgef11 APN 3 87733160 missense probably benign 0.07
IGL03017:Arhgef11 APN 3 87717060 nonsense probably null
ANU05:Arhgef11 UTSW 3 87733174 missense probably benign 0.00
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0129:Arhgef11 UTSW 3 87728063 missense probably damaging 1.00
R0698:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0701:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0849:Arhgef11 UTSW 3 87735896 missense probably benign 0.24
R1055:Arhgef11 UTSW 3 87717118 missense probably benign 0.19
R1256:Arhgef11 UTSW 3 87727135 missense possibly damaging 0.81
R1401:Arhgef11 UTSW 3 87733469 nonsense probably null
R1543:Arhgef11 UTSW 3 87713017 missense probably benign 0.10
R1547:Arhgef11 UTSW 3 87695402 missense possibly damaging 0.87
R1564:Arhgef11 UTSW 3 87702510 missense probably benign
R1675:Arhgef11 UTSW 3 87731211 missense possibly damaging 0.84
R2082:Arhgef11 UTSW 3 87725996 missense possibly damaging 0.47
R2293:Arhgef11 UTSW 3 87727990 missense probably damaging 1.00
R4739:Arhgef11 UTSW 3 87697999 missense possibly damaging 0.47
R4930:Arhgef11 UTSW 3 87728594 missense probably damaging 1.00
R5130:Arhgef11 UTSW 3 87726014 missense possibly damaging 0.71
R5151:Arhgef11 UTSW 3 87735360 missense probably damaging 1.00
R5157:Arhgef11 UTSW 3 87728510 splice site probably null
R5203:Arhgef11 UTSW 3 87735357 missense probably damaging 1.00
R5329:Arhgef11 UTSW 3 87679752 intron probably benign
R5615:Arhgef11 UTSW 3 87722485 critical splice donor site probably null
R5646:Arhgef11 UTSW 3 87684486 missense possibly damaging 0.94
R6125:Arhgef11 UTSW 3 87729602 missense probably damaging 1.00
R6242:Arhgef11 UTSW 3 87728078 missense probably benign
R6543:Arhgef11 UTSW 3 87733408 missense probably benign 0.09
R6801:Arhgef11 UTSW 3 87735852 missense possibly damaging 0.53
R6939:Arhgef11 UTSW 3 87686920 missense probably damaging 1.00
R7008:Arhgef11 UTSW 3 87729218 missense possibly damaging 0.92
R7155:Arhgef11 UTSW 3 87709572 nonsense probably null
R7169:Arhgef11 UTSW 3 87727448 missense possibly damaging 0.79
R7325:Arhgef11 UTSW 3 87713292 missense possibly damaging 0.62
R7392:Arhgef11 UTSW 3 87717175 critical splice donor site probably null
R7683:Arhgef11 UTSW 3 87722383 missense probably damaging 0.98
R7875:Arhgef11 UTSW 3 87684501 missense probably damaging 1.00
R7912:Arhgef11 UTSW 3 87733222 missense probably damaging 1.00
R8028:Arhgef11 UTSW 3 87735552 missense probably benign
R8081:Arhgef11 UTSW 3 87725642 missense probably damaging 1.00
R8118:Arhgef11 UTSW 3 87735857 missense probably damaging 1.00
R8207:Arhgef11 UTSW 3 87698775 missense possibly damaging 0.71
R8290:Arhgef11 UTSW 3 87725968 missense probably damaging 1.00
X0011:Arhgef11 UTSW 3 87722406 missense probably benign
Z1176:Arhgef11 UTSW 3 87735462 missense not run
Predicted Primers PCR Primer
(F):5'- CTTTCCTCACCCAGGAATGAGCAG -3'
(R):5'- GCCAGAGGCAACCCTTTAATGGTC -3'

Sequencing Primer
(F):5'- CACCCAGGAATGAGCAGATATCAG -3'
(R):5'- ctgaggactgaaccaaggac -3'
Posted On2013-05-23