Incidental Mutation 'R5348:Ppip5k2'
ID422716
Institutional Source Beutler Lab
Gene Symbol Ppip5k2
Ensembl Gene ENSMUSG00000040648
Gene Namediphosphoinositol pentakisphosphate kinase 2
SynonymsHisppd1, Vip2
MMRRC Submission 042927-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R5348 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location97706048-97770411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97747592 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 362 (L362S)
Ref Sequence ENSEMBL: ENSMUSP00000108466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042509] [ENSMUST00000112845] [ENSMUST00000171129]
Predicted Effect probably benign
Transcript: ENSMUST00000042509
AA Change: L368S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043401
Gene: ENSMUSG00000040648
AA Change: L368S

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 2.9e-112 PFAM
low complexity region 1073 1092 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112845
AA Change: L362S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108466
Gene: ENSMUSG00000040648
AA Change: L362S

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 6.9e-141 PFAM
low complexity region 993 1006 N/A INTRINSIC
low complexity region 1192 1211 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152788
Predicted Effect probably benign
Transcript: ENSMUST00000171129
AA Change: L362S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132889
Gene: ENSMUSG00000040648
AA Change: L362S

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 2.9e-112 PFAM
low complexity region 1073 1092 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine acid phosphatase family of proteins. Despite containing a histidine acid phosphatase domain, the encoded protein functions as an inositol pyrophosphate kinase, and is thought to lack phosphatase activity. This kinase activity is the mechanism by which the encoded protein synthesizes high-energy inositol pyrophosphates, which act as signaling molecules that regulate cellular homeostasis and other processes. This gene may be associated with autism spectrum disorder in human patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,048,146 E1331G probably damaging Het
Abcg5 A T 17: 84,671,206 C275S possibly damaging Het
Cdk12 T A 11: 98,204,292 S309T probably benign Het
Cep295nl T C 11: 118,333,599 R140G probably damaging Het
Chd8 A G 14: 52,232,698 V485A probably damaging Het
Chn2 A G 6: 54,300,218 I279V probably damaging Het
Cux2 A G 5: 121,865,978 S1032P probably damaging Het
Ddx55 T A 5: 124,554,565 M44K probably damaging Het
Dpyd T A 3: 118,781,943 H143Q probably benign Het
Fbxo10 A G 4: 45,058,934 W268R probably damaging Het
Gmfg A G 7: 28,446,394 D86G probably benign Het
Gpd1 T C 15: 99,722,140 V273A possibly damaging Het
Grhpr T C 4: 44,985,393 I158T probably damaging Het
Itpr2 A G 6: 146,476,693 F53L possibly damaging Het
Kctd21 A G 7: 97,347,970 I217V probably benign Het
Lrfn2 A G 17: 49,096,690 T614A probably benign Het
Lrrc7 T A 3: 158,175,326 D491V probably benign Het
Myo7b T C 18: 31,983,919 E916G probably damaging Het
Nf1 C T 11: 79,564,899 T550I probably damaging Het
Nsd1 A G 13: 55,312,334 T2125A probably benign Het
Olfml2b A G 1: 170,662,426 E205G probably benign Het
Olfr1084 A T 2: 86,638,806 L301I probably benign Het
Papolb T C 5: 142,529,217 T224A possibly damaging Het
Pcnx2 T C 8: 125,818,756 E1172G probably damaging Het
Ppp1r9b T A 11: 94,996,612 Y59* probably null Het
Pramef8 T C 4: 143,416,781 L39P probably damaging Het
Rapgef5 T A 12: 117,688,611 S76R probably benign Het
Rnh1 A T 7: 141,163,408 V218D probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc4a7 G T 14: 14,786,310 V999L probably benign Het
Slco4c1 A T 1: 96,842,529 I270N probably damaging Het
Tdp1 A G 12: 99,915,506 Y498C probably damaging Het
Tfip11 A G 5: 112,335,668 S650G probably benign Het
Ttn T C 2: 76,778,294 T17793A possibly damaging Het
Ulk2 T C 11: 61,783,613 T856A probably benign Het
Vps13d C T 4: 145,065,889 G3726E probably damaging Het
Other mutations in Ppip5k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Ppip5k2 APN 1 97713123 missense probably damaging 1.00
IGL02266:Ppip5k2 APN 1 97733972 missense possibly damaging 0.68
IGL02705:Ppip5k2 APN 1 97759199 missense probably damaging 1.00
IGL03229:Ppip5k2 APN 1 97728961 missense probably damaging 1.00
P0033:Ppip5k2 UTSW 1 97717528 missense probably damaging 0.98
R0082:Ppip5k2 UTSW 1 97759332 nonsense probably null
R0242:Ppip5k2 UTSW 1 97741091 missense probably damaging 1.00
R0242:Ppip5k2 UTSW 1 97741091 missense probably damaging 1.00
R0267:Ppip5k2 UTSW 1 97728997 missense probably damaging 1.00
R0281:Ppip5k2 UTSW 1 97716553 missense possibly damaging 0.95
R0373:Ppip5k2 UTSW 1 97740537 nonsense probably null
R0402:Ppip5k2 UTSW 1 97719854 missense probably benign 0.00
R0423:Ppip5k2 UTSW 1 97761427 missense possibly damaging 0.95
R0613:Ppip5k2 UTSW 1 97752740 nonsense probably null
R0751:Ppip5k2 UTSW 1 97749652 nonsense probably null
R1121:Ppip5k2 UTSW 1 97756860 missense probably damaging 1.00
R1265:Ppip5k2 UTSW 1 97719900 missense probably benign 0.00
R1436:Ppip5k2 UTSW 1 97711782 missense probably benign 0.04
R1543:Ppip5k2 UTSW 1 97740882 missense probably damaging 1.00
R1739:Ppip5k2 UTSW 1 97728957 missense probably damaging 1.00
R1845:Ppip5k2 UTSW 1 97723806 missense possibly damaging 0.74
R2191:Ppip5k2 UTSW 1 97744110 missense probably damaging 0.99
R2430:Ppip5k2 UTSW 1 97735030 missense probably damaging 1.00
R2762:Ppip5k2 UTSW 1 97717509 missense probably damaging 1.00
R3014:Ppip5k2 UTSW 1 97744075 missense probably damaging 0.99
R3759:Ppip5k2 UTSW 1 97755885 critical splice donor site probably null
R4603:Ppip5k2 UTSW 1 97755136 missense probably damaging 1.00
R4772:Ppip5k2 UTSW 1 97721067 unclassified probably benign
R4951:Ppip5k2 UTSW 1 97711749 missense possibly damaging 0.77
R5350:Ppip5k2 UTSW 1 97721128 missense probably damaging 0.98
R5584:Ppip5k2 UTSW 1 97750641 missense probably damaging 1.00
R5599:Ppip5k2 UTSW 1 97740598 missense probably damaging 1.00
R5883:Ppip5k2 UTSW 1 97707810 missense possibly damaging 0.53
R5898:Ppip5k2 UTSW 1 97744162 intron probably benign
R6184:Ppip5k2 UTSW 1 97734005 missense possibly damaging 0.89
R6221:Ppip5k2 UTSW 1 97730028 missense probably damaging 1.00
R6775:Ppip5k2 UTSW 1 97719860 missense possibly damaging 0.49
R7250:Ppip5k2 UTSW 1 97745462 missense probably benign 0.00
R7329:Ppip5k2 UTSW 1 97750753 splice site probably null
R7357:Ppip5k2 UTSW 1 97759216 missense possibly damaging 0.91
R7852:Ppip5k2 UTSW 1 97741171 missense probably damaging 0.99
R7884:Ppip5k2 UTSW 1 97740482 missense probably benign 0.00
R8006:Ppip5k2 UTSW 1 97734106 missense probably benign 0.00
R8134:Ppip5k2 UTSW 1 97745163 missense probably benign 0.12
R8274:Ppip5k2 UTSW 1 97759216 missense possibly damaging 0.91
R8436:Ppip5k2 UTSW 1 97755888 missense probably benign
R8440:Ppip5k2 UTSW 1 97747551 missense probably damaging 0.99
R8730:Ppip5k2 UTSW 1 97761431 small deletion probably benign
R8895:Ppip5k2 UTSW 1 97711819 missense probably benign
Z1177:Ppip5k2 UTSW 1 97716605 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCTAAGCTTTAGCATACCCTTG -3'
(R):5'- CTGGAAATGTAGTTAGAGCAACATG -3'

Sequencing Primer
(F):5'- AGCTTTAGCATACCCTTGTAAAAAC -3'
(R):5'- AAGAACAGTCGGGTGCTCTTACC -3'
Posted On2016-08-04