Mutagenetix > Incidental Mutations

Incidental Mutation 'R0486:Nr4a3'

42272

Institutional Source

Beutler Lab

Gene Symbol

Nr4a3

Ensembl Gene

ENSMUSG00000028341

Gene Name

nuclear receptor subfamily 4, group A, member 3

Synonyms

Nor1, TEC, MINOR, NOR-1

MMRRC Submission

038685-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0486 (G1)

Quality Score

158

Status

Validated

Chromosome

Chromosomal Location

48045153-48086447 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 48056525 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030025]

Predicted Effect

probably benign
Transcript: ENSMUST00000030025

SMART Domains

Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341

Domain	Start	End	E-Value	Type
Blast:HOLI	1	43	4e-18	BLAST
low complexity region	99	115	N/A	INTRINSIC
low complexity region	139	151	N/A	INTRINSIC
low complexity region	196	210	N/A	INTRINSIC
low complexity region	218	239	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
ZnF_C4	290	361	4.57e-39	SMART
low complexity region	376	396	N/A	INTRINSIC
HOLI	440	595	2.46e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133539

Predicted Effect

probably benign
Transcript: ENSMUST00000153369

SMART Domains

Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341

Domain	Start	End	E-Value	Type
Blast:HOLI	30	73	8e-19	BLAST
low complexity region	129	145	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC
low complexity region	226	240	N/A	INTRINSIC
low complexity region	248	269	N/A	INTRINSIC
low complexity region	299	318	N/A	INTRINSIC
ZnF_C4	320	391	4.57e-39	SMART
low complexity region	406	426	N/A	INTRINSIC
HOLI	470	625	2.46e-21	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco1	T	C	4: 40,177,783	L268P	probably damaging	Het
Adam22	A	T	5: 8,330,048	H83Q	probably damaging	Het
Anln	T	C	9: 22,352,826	D886G	probably benign	Het
Arhgef11	T	A	3: 87,688,852		probably null	Het
Arl8b	A	T	6: 108,815,326	D116V	possibly damaging	Het
BC051665	C	T	13: 60,784,045	G180D	probably damaging	Het
Bloc1s2	A	G	19: 44,143,150		probably benign	Het
Ccdc185	T	G	1: 182,747,859	S422R	possibly damaging	Het
Cd101	T	C	3: 101,008,092	K720E	possibly damaging	Het
Cdh23	C	A	10: 60,386,946	A1236S	probably damaging	Het
Chd1	G	A	17: 15,734,342	A491T	probably damaging	Het
Chdh	T	C	14: 30,032,858	V275A	possibly damaging	Het
Cmtm2b	A	T	8: 104,330,415	I136F	probably damaging	Het
Cps1	T	C	1: 67,165,392	V457A	probably damaging	Het
Cwf19l1	A	G	19: 44,114,690	V362A	probably benign	Het
Cyp4f17	T	C	17: 32,524,823		probably benign	Het
Cyp4f18	C	A	8: 71,996,017	V263L	probably benign	Het
Dclre1a	A	G	19: 56,541,490		probably benign	Het
Dpp6	T	C	5: 27,661,642	I446T	probably benign	Het
F11r	T	C	1: 171,460,588	W61R	probably damaging	Het
Fam120b	C	T	17: 15,426,288		probably benign	Het
Fastkd2	T	C	1: 63,752,340	V669A	possibly damaging	Het
Foxg1	T	C	12: 49,384,531		probably benign	Het
Foxo3	A	G	10: 42,197,481	Y347H	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gbp7	C	A	3: 142,546,317		probably benign	Het
Glipr1	T	C	10: 111,996,849		probably benign	Het
Gm11555	A	G	11: 99,650,160	S8P	unknown	Het
H6pd	G	A	4: 149,982,936		probably benign	Het
Haus8	C	A	8: 71,256,537	G76W	probably damaging	Het
Haus8	C	T	8: 71,256,538	M75I	probably benign	Het
Kcnj13	C	A	1: 87,387,030	V157L	probably damaging	Het
Kcnt2	T	A	1: 140,509,480	C550*	probably null	Het
Kdm5d	A	G	Y: 927,107	N615S	probably damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ncapd2	G	A	6: 125,184,027	R292*	probably null	Het
Ngef	T	A	1: 87,479,126	N640I	probably damaging	Het
Nhlrc3	T	C	3: 53,452,437	Y335C	probably damaging	Het
Nipbl	A	T	15: 8,338,870		probably benign	Het
Nop2	A	G	6: 125,140,673	K434R	probably null	Het
Olfr881	A	G	9: 37,992,702	N70S	possibly damaging	Het
Piezo2	A	C	18: 63,029,061	I2233R	probably damaging	Het
Prag1	A	T	8: 36,146,633	E1113V	probably damaging	Het
Prpsap2	A	G	11: 61,741,000	I177T	possibly damaging	Het
Psmd1	T	A	1: 86,094,290	N611K	probably damaging	Het
Ptpn7	C	T	1: 135,137,358	T168I	probably damaging	Het
Pus1	A	T	5: 110,779,730	V53E	probably damaging	Het
Rgs22	A	G	15: 36,092,882	M415T	probably damaging	Het
Rnf165	T	A	18: 77,484,254	Q91L	probably damaging	Het
Rnf17	C	T	14: 56,514,175	T1490M	probably benign	Het
Rnf20	C	A	4: 49,645,907	L332I	possibly damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spam1	A	T	6: 24,796,395	Q115L	probably damaging	Het
Syce1l	A	T	8: 113,654,763		probably null	Het
Synj1	T	C	16: 90,938,263		probably benign	Het
Tas2r126	A	T	6: 42,435,291	I253F	probably benign	Het
Tecpr2	G	A	12: 110,896,369	V72I	probably benign	Het
Tfap2a	G	T	13: 40,728,694	P45Q	probably damaging	Het
Trip12	C	A	1: 84,761,084	G714*	probably null	Het
Wdr31	A	G	4: 62,453,893	S330P	probably damaging	Het
Wdr64	T	C	1: 175,795,203		probably benign	Het
Yes1	T	A	5: 32,655,582	Y343*	probably null	Het

Other mutations in Nr4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Nr4a3	APN	4	48051586	missense	possibly damaging	0.48
IGL01407:Nr4a3	APN	4	48083201	missense	probably benign	0.00
IGL01454:Nr4a3	APN	4	48067803	missense	probably damaging	1.00
IGL01472:Nr4a3	APN	4	48071133	missense	probably damaging	1.00
IGL02622:Nr4a3	APN	4	48051649	missense	probably benign	0.06
IGL03401:Nr4a3	APN	4	48070987	splice site	probably null
bulbous	UTSW	4	48083255	missense	probably damaging	0.98
cronus	UTSW	4	48056539	missense	probably damaging	1.00
I1329:Nr4a3	UTSW	4	48051585	missense	probably benign	0.12
R0610:Nr4a3	UTSW	4	48051903	missense	probably benign	0.10
R1170:Nr4a3	UTSW	4	48051564	missense	probably damaging	0.98
R1170:Nr4a3	UTSW	4	48083324	missense	probably benign	0.01
R1440:Nr4a3	UTSW	4	48051777	missense	probably benign
R1977:Nr4a3	UTSW	4	48056539	missense	probably damaging	1.00
R2016:Nr4a3	UTSW	4	48083252	missense	probably damaging	1.00
R2046:Nr4a3	UTSW	4	48067807	missense	possibly damaging	0.82
R2055:Nr4a3	UTSW	4	48067771	missense	possibly damaging	0.86
R3707:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R3708:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R4246:Nr4a3	UTSW	4	48083125	missense	possibly damaging	0.86
R4657:Nr4a3	UTSW	4	48051522	missense	probably damaging	1.00
R4870:Nr4a3	UTSW	4	48051651	missense	possibly damaging	0.73
R5434:Nr4a3	UTSW	4	48067861	missense	probably damaging	1.00
R5539:Nr4a3	UTSW	4	48056525	splice site	probably null
R5663:Nr4a3	UTSW	4	48055931	missense	probably damaging	1.00
R6513:Nr4a3	UTSW	4	48083255	missense	probably damaging	0.98
R6664:Nr4a3	UTSW	4	48056006	missense	probably damaging	1.00
R6921:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R6940:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R7076:Nr4a3	UTSW	4	48055957	missense	probably damaging	1.00
R7322:Nr4a3	UTSW	4	48083238	missense	probably benign	0.00
R7347:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7348:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7349:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7361:Nr4a3	UTSW	4	48083203	missense	probably benign	0.00
R7365:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7366:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7418:Nr4a3	UTSW	4	48051476	missense	probably damaging	1.00
R7659:Nr4a3	UTSW	4	48051269	missense	probably damaging	1.00
R7895:Nr4a3	UTSW	4	48051390	missense	probably benign
R7986:Nr4a3	UTSW	4	48055954	missense	probably damaging	1.00
R8022:Nr4a3	UTSW	4	48051510	missense	probably damaging	1.00
R8226:Nr4a3	UTSW	4	48056588	missense	probably damaging	1.00
R8328:Nr4a3	UTSW	4	48051323	missense	probably damaging	1.00
R8349:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40
R8403:Nr4a3	UTSW	4	48051348	missense	probably damaging	1.00
R8449:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- CGCTGTTCCGAACTTAACACTGCTC -3'
(R):5'- TGACTAGCACAATGCCAGGCAC -3'

Sequencing Primer
(F):5'- CTTAACACTGCTCTGAAATGGG -3'
(R):5'- TGCCAGGCACAGTCATTTAAC -3'

Posted On

2013-05-23