Incidental Mutation 'R0486:Nr4a3'
ID42272
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission 038685-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0486 (G1)
Quality Score158
Status Validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 48056525 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect probably benign
Transcript: ENSMUST00000030025
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133539
Predicted Effect probably benign
Transcript: ENSMUST00000153369
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 T C 4: 40,177,783 L268P probably damaging Het
Adam22 A T 5: 8,330,048 H83Q probably damaging Het
Anln T C 9: 22,352,826 D886G probably benign Het
Arhgef11 T A 3: 87,688,852 probably null Het
Arl8b A T 6: 108,815,326 D116V possibly damaging Het
BC051665 C T 13: 60,784,045 G180D probably damaging Het
Bloc1s2 A G 19: 44,143,150 probably benign Het
Ccdc185 T G 1: 182,747,859 S422R possibly damaging Het
Cd101 T C 3: 101,008,092 K720E possibly damaging Het
Cdh23 C A 10: 60,386,946 A1236S probably damaging Het
Chd1 G A 17: 15,734,342 A491T probably damaging Het
Chdh T C 14: 30,032,858 V275A possibly damaging Het
Cmtm2b A T 8: 104,330,415 I136F probably damaging Het
Cps1 T C 1: 67,165,392 V457A probably damaging Het
Cwf19l1 A G 19: 44,114,690 V362A probably benign Het
Cyp4f17 T C 17: 32,524,823 probably benign Het
Cyp4f18 C A 8: 71,996,017 V263L probably benign Het
Dclre1a A G 19: 56,541,490 probably benign Het
Dpp6 T C 5: 27,661,642 I446T probably benign Het
F11r T C 1: 171,460,588 W61R probably damaging Het
Fam120b C T 17: 15,426,288 probably benign Het
Fastkd2 T C 1: 63,752,340 V669A possibly damaging Het
Foxg1 T C 12: 49,384,531 probably benign Het
Foxo3 A G 10: 42,197,481 Y347H probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gbp7 C A 3: 142,546,317 probably benign Het
Glipr1 T C 10: 111,996,849 probably benign Het
Gm11555 A G 11: 99,650,160 S8P unknown Het
H6pd G A 4: 149,982,936 probably benign Het
Haus8 C A 8: 71,256,537 G76W probably damaging Het
Haus8 C T 8: 71,256,538 M75I probably benign Het
Kcnj13 C A 1: 87,387,030 V157L probably damaging Het
Kcnt2 T A 1: 140,509,480 C550* probably null Het
Kdm5d A G Y: 927,107 N615S probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Ngef T A 1: 87,479,126 N640I probably damaging Het
Nhlrc3 T C 3: 53,452,437 Y335C probably damaging Het
Nipbl A T 15: 8,338,870 probably benign Het
Nop2 A G 6: 125,140,673 K434R probably null Het
Olfr881 A G 9: 37,992,702 N70S possibly damaging Het
Piezo2 A C 18: 63,029,061 I2233R probably damaging Het
Prag1 A T 8: 36,146,633 E1113V probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Psmd1 T A 1: 86,094,290 N611K probably damaging Het
Ptpn7 C T 1: 135,137,358 T168I probably damaging Het
Pus1 A T 5: 110,779,730 V53E probably damaging Het
Rgs22 A G 15: 36,092,882 M415T probably damaging Het
Rnf165 T A 18: 77,484,254 Q91L probably damaging Het
Rnf17 C T 14: 56,514,175 T1490M probably benign Het
Rnf20 C A 4: 49,645,907 L332I possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spam1 A T 6: 24,796,395 Q115L probably damaging Het
Syce1l A T 8: 113,654,763 probably null Het
Synj1 T C 16: 90,938,263 probably benign Het
Tas2r126 A T 6: 42,435,291 I253F probably benign Het
Tecpr2 G A 12: 110,896,369 V72I probably benign Het
Tfap2a G T 13: 40,728,694 P45Q probably damaging Het
Trip12 C A 1: 84,761,084 G714* probably null Het
Wdr31 A G 4: 62,453,893 S330P probably damaging Het
Wdr64 T C 1: 175,795,203 probably benign Het
Yes1 T A 5: 32,655,582 Y343* probably null Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R7986:Nr4a3 UTSW 4 48055954 missense probably damaging 1.00
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
R8226:Nr4a3 UTSW 4 48056588 missense probably damaging 1.00
R8328:Nr4a3 UTSW 4 48051323 missense probably damaging 1.00
R8349:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
R8403:Nr4a3 UTSW 4 48051348 missense probably damaging 1.00
R8449:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CGCTGTTCCGAACTTAACACTGCTC -3'
(R):5'- TGACTAGCACAATGCCAGGCAC -3'

Sequencing Primer
(F):5'- CTTAACACTGCTCTGAAATGGG -3'
(R):5'- TGCCAGGCACAGTCATTTAAC -3'
Posted On2013-05-23