Incidental Mutation 'R5348:Tfip11'
ID422727
Institutional Source Beutler Lab
Gene Symbol Tfip11
Ensembl Gene ENSMUSG00000029345
Gene Nametuftelin interacting protein 11
SynonymsTip39
MMRRC Submission 042927-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5348 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location112326358-112338073 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112335668 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 650 (S650G)
Ref Sequence ENSEMBL: ENSMUSP00000031288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031288] [ENSMUST00000031289] [ENSMUST00000146510] [ENSMUST00000198238]
Predicted Effect probably benign
Transcript: ENSMUST00000031288
AA Change: S650G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031288
Gene: ENSMUSG00000029345
AA Change: S650G

DomainStartEndE-ValueType
Pfam:TIP_N 17 114 1.4e-30 PFAM
G_patch 148 194 3.3e-18 SMART
low complexity region 212 218 N/A INTRINSIC
low complexity region 228 242 N/A INTRINSIC
Pfam:GCFC 398 667 3.4e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031289
SMART Domains Protein: ENSMUSP00000031289
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
Pfam:SRR1 109 164 2.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126736
Predicted Effect probably benign
Transcript: ENSMUST00000146510
SMART Domains Protein: ENSMUSP00000119870
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
Pfam:SRR1 109 162 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156083
Predicted Effect probably benign
Transcript: ENSMUST00000198238
SMART Domains Protein: ENSMUSP00000142844
Gene: ENSMUSG00000029345

DomainStartEndE-ValueType
G_patch 8 54 1.9e-20 SMART
low complexity region 72 78 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of the spliceosome that promotes the release of the lariat-intron during late-stage splicing through the recruitment of a pre-mRNA splicing factor called DEAH-box helicase 15. The encoded protein contains a G-patch domain, a hallmark of RNA-processing proteins, that binds DEAH-box helicase 15. This protein contains an atypical nuclear localization sequence as well as a nuclear speckle-targeting sequence, enabling it to localize to distinct speckled regions within the cell nucleus. Polymorphisms in this gene are associated with dental caries suggesting a role in amelogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,048,146 E1331G probably damaging Het
Abcg5 A T 17: 84,671,206 C275S possibly damaging Het
Cdk12 T A 11: 98,204,292 S309T probably benign Het
Cep295nl T C 11: 118,333,599 R140G probably damaging Het
Chd8 A G 14: 52,232,698 V485A probably damaging Het
Chn2 A G 6: 54,300,218 I279V probably damaging Het
Cux2 A G 5: 121,865,978 S1032P probably damaging Het
Ddx55 T A 5: 124,554,565 M44K probably damaging Het
Dpyd T A 3: 118,781,943 H143Q probably benign Het
Fbxo10 A G 4: 45,058,934 W268R probably damaging Het
Gmfg A G 7: 28,446,394 D86G probably benign Het
Gpd1 T C 15: 99,722,140 V273A possibly damaging Het
Grhpr T C 4: 44,985,393 I158T probably damaging Het
Itpr2 A G 6: 146,476,693 F53L possibly damaging Het
Kctd21 A G 7: 97,347,970 I217V probably benign Het
Lrfn2 A G 17: 49,096,690 T614A probably benign Het
Lrrc7 T A 3: 158,175,326 D491V probably benign Het
Myo7b T C 18: 31,983,919 E916G probably damaging Het
Nf1 C T 11: 79,564,899 T550I probably damaging Het
Nsd1 A G 13: 55,312,334 T2125A probably benign Het
Olfml2b A G 1: 170,662,426 E205G probably benign Het
Olfr1084 A T 2: 86,638,806 L301I probably benign Het
Papolb T C 5: 142,529,217 T224A possibly damaging Het
Pcnx2 T C 8: 125,818,756 E1172G probably damaging Het
Ppip5k2 A G 1: 97,747,592 L362S possibly damaging Het
Ppp1r9b T A 11: 94,996,612 Y59* probably null Het
Pramef8 T C 4: 143,416,781 L39P probably damaging Het
Rapgef5 T A 12: 117,688,611 S76R probably benign Het
Rnh1 A T 7: 141,163,408 V218D probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc4a7 G T 14: 14,786,310 V999L probably benign Het
Slco4c1 A T 1: 96,842,529 I270N probably damaging Het
Tdp1 A G 12: 99,915,506 Y498C probably damaging Het
Ttn T C 2: 76,778,294 T17793A possibly damaging Het
Ulk2 T C 11: 61,783,613 T856A probably benign Het
Vps13d C T 4: 145,065,889 G3726E probably damaging Het
Other mutations in Tfip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Tfip11 APN 5 112329503 missense possibly damaging 0.51
IGL02627:Tfip11 APN 5 112329813 missense possibly damaging 0.69
R0023:Tfip11 UTSW 5 112332009 missense possibly damaging 0.47
R0254:Tfip11 UTSW 5 112335655 missense probably benign 0.06
R0465:Tfip11 UTSW 5 112333264 missense probably benign 0.32
R0569:Tfip11 UTSW 5 112328094 missense probably damaging 1.00
R1411:Tfip11 UTSW 5 112333033 missense probably benign 0.00
R1751:Tfip11 UTSW 5 112334432 missense probably damaging 1.00
R1767:Tfip11 UTSW 5 112334432 missense probably damaging 1.00
R1792:Tfip11 UTSW 5 112329397 missense possibly damaging 0.95
R2125:Tfip11 UTSW 5 112335663 missense possibly damaging 0.46
R4781:Tfip11 UTSW 5 112333399 missense probably damaging 0.99
R4975:Tfip11 UTSW 5 112335747 unclassified probably benign
R5385:Tfip11 UTSW 5 112331220 critical splice donor site probably null
R5469:Tfip11 UTSW 5 112334325 nonsense probably null
R6540:Tfip11 UTSW 5 112334397 splice site probably null
R6810:Tfip11 UTSW 5 112333597 missense probably benign 0.07
R7199:Tfip11 UTSW 5 112331178 missense probably benign 0.16
R7342:Tfip11 UTSW 5 112327972 start codon destroyed probably null 0.99
R7352:Tfip11 UTSW 5 112333268 missense probably benign
R7921:Tfip11 UTSW 5 112335576 missense probably benign 0.03
R8070:Tfip11 UTSW 5 112334930 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTTAAGTGCTTGTGACTCATGG -3'
(R):5'- CACTACAGGGCACATGAAGC -3'

Sequencing Primer
(F):5'- ACTCATGGGATTCACTGTGG -3'
(R):5'- GCTTCTAGCAGTTACCAGGAGAATC -3'
Posted On2016-08-04