Mutagenetix > Incidental Mutations

Incidental Mutation 'R5348:Cux2'

422728

Institutional Source

Beutler Lab

Gene Symbol

Cux2

Ensembl Gene

ENSMUSG00000042589

Gene Name

cut-like homeobox 2

Synonyms

Cutl2, Cux-2, ENSMUSG00000072641, 1700051K22Rik, Cux2

MMRRC Submission

042927-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.323) question?

Stock #

R5348 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121856366-122050102 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121865978 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1032 (S1032P)

Ref Sequence

ENSEMBL: ENSMUSP00000130302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086317] [ENSMUST00000111752] [ENSMUST00000168288]

Predicted Effect

probably damaging
Transcript: ENSMUST00000086317
AA Change: S1032P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000083497
Gene: ENSMUSG00000042589
AA Change: S1032P

Domain	Start	End	E-Value	Type
coiled coil region	133	214	N/A	INTRINSIC
coiled coil region	235	311	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC
low complexity region	397	408	N/A	INTRINSIC
low complexity region	459	474	N/A	INTRINSIC
CUT	484	569	7.62e-34	SMART
coiled coil region	626	655	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	740	757	N/A	INTRINSIC
CUT	829	917	6.52e-42	SMART
low complexity region	965	976	N/A	INTRINSIC
CUT	984	1070	1.12e-40	SMART
HOX	1113	1175	7.54e-13	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111752
AA Change: S1032P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107381
Gene: ENSMUSG00000042589
AA Change: S1032P

Domain	Start	End	E-Value	Type
coiled coil region	133	214	N/A	INTRINSIC
coiled coil region	235	311	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC
low complexity region	397	408	N/A	INTRINSIC
low complexity region	459	474	N/A	INTRINSIC
CUT	484	569	7.62e-34	SMART
coiled coil region	626	655	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	740	757	N/A	INTRINSIC
CUT	829	917	6.52e-42	SMART
low complexity region	965	976	N/A	INTRINSIC
CUT	984	1070	1.12e-40	SMART
HOX	1113	1175	7.54e-13	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168288
AA Change: S1032P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000130302
Gene: ENSMUSG00000042589
AA Change: S1032P

Domain	Start	End	E-Value	Type
coiled coil region	133	214	N/A	INTRINSIC
coiled coil region	235	311	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC
low complexity region	397	408	N/A	INTRINSIC
low complexity region	459	474	N/A	INTRINSIC
CUT	484	569	7.62e-34	SMART
coiled coil region	626	655	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	740	757	N/A	INTRINSIC
CUT	829	917	6.52e-42	SMART
low complexity region	965	976	N/A	INTRINSIC
CUT	984	1070	1.12e-40	SMART
HOX	1113	1175	7.54e-13	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197179

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene is a member of the Cut family of transcription factors that have multiple DNA binding domains and regulate cell proliferation and differentiation. This gene is primarily expressed in nervous tissues where it controls the proliferation of neuronal precursors, and may play a role in organogenesis earlier during embryonic development. Mice lacking the encoded protein exhibit smaller spinal cords with deficits in neural progenitor development as well as in neuroblast and interneuron differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit various neural defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 37,048,146	E1331G	probably damaging	Het
Abcg5	A	T	17: 84,671,206	C275S	possibly damaging	Het
Cdk12	T	A	11: 98,204,292	S309T	probably benign	Het
Cep295nl	T	C	11: 118,333,599	R140G	probably damaging	Het
Chd8	A	G	14: 52,232,698	V485A	probably damaging	Het
Chn2	A	G	6: 54,300,218	I279V	probably damaging	Het
Ddx55	T	A	5: 124,554,565	M44K	probably damaging	Het
Dpyd	T	A	3: 118,781,943	H143Q	probably benign	Het
Fbxo10	A	G	4: 45,058,934	W268R	probably damaging	Het
Gmfg	A	G	7: 28,446,394	D86G	probably benign	Het
Gpd1	T	C	15: 99,722,140	V273A	possibly damaging	Het
Grhpr	T	C	4: 44,985,393	I158T	probably damaging	Het
Itpr2	A	G	6: 146,476,693	F53L	possibly damaging	Het
Kctd21	A	G	7: 97,347,970	I217V	probably benign	Het
Lrfn2	A	G	17: 49,096,690	T614A	probably benign	Het
Lrrc7	T	A	3: 158,175,326	D491V	probably benign	Het
Myo7b	T	C	18: 31,983,919	E916G	probably damaging	Het
Nf1	C	T	11: 79,564,899	T550I	probably damaging	Het
Nsd1	A	G	13: 55,312,334	T2125A	probably benign	Het
Olfml2b	A	G	1: 170,662,426	E205G	probably benign	Het
Olfr1084	A	T	2: 86,638,806	L301I	probably benign	Het
Papolb	T	C	5: 142,529,217	T224A	possibly damaging	Het
Pcnx2	T	C	8: 125,818,756	E1172G	probably damaging	Het
Ppip5k2	A	G	1: 97,747,592	L362S	possibly damaging	Het
Ppp1r9b	T	A	11: 94,996,612	Y59*	probably null	Het
Pramef8	T	C	4: 143,416,781	L39P	probably damaging	Het
Rapgef5	T	A	12: 117,688,611	S76R	probably benign	Het
Rnh1	A	T	7: 141,163,408	V218D	probably damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Slc4a7	G	T	14: 14,786,310	V999L	probably benign	Het
Slco4c1	A	T	1: 96,842,529	I270N	probably damaging	Het
Tdp1	A	G	12: 99,915,506	Y498C	probably damaging	Het
Tfip11	A	G	5: 112,335,668	S650G	probably benign	Het
Ttn	T	C	2: 76,778,294	T17793A	possibly damaging	Het
Ulk2	T	C	11: 61,783,613	T856A	probably benign	Het
Vps13d	C	T	4: 145,065,889	G3726E	probably damaging	Het

Other mutations in Cux2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Cux2	APN	5	121868538	missense	possibly damaging	0.92
IGL00917:Cux2	APN	5	121869105	missense	probably null	0.05
IGL00979:Cux2	APN	5	121873714	missense	probably damaging	0.98
IGL01069:Cux2	APN	5	121867351	missense	possibly damaging	0.84
IGL01303:Cux2	APN	5	121865928	missense	probably benign	0.03
IGL01583:Cux2	APN	5	121874107	missense	probably damaging	0.98
IGL01762:Cux2	APN	5	121873145	missense	probably damaging	1.00
IGL02508:Cux2	APN	5	121860822	missense	possibly damaging	0.93
R0333:Cux2	UTSW	5	121860608	missense	probably benign	0.04
R0352:Cux2	UTSW	5	121884739	splice site	probably benign
R0443:Cux2	UTSW	5	121887437	missense	possibly damaging	0.66
R1853:Cux2	UTSW	5	121869121	missense	possibly damaging	0.95
R2011:Cux2	UTSW	5	121861326	missense	probably benign	0.21
R2057:Cux2	UTSW	5	121869504	missense	probably benign	0.02
R2165:Cux2	UTSW	5	121887477	missense	possibly damaging	0.78
R3964:Cux2	UTSW	5	121887476	nonsense	probably null
R4182:Cux2	UTSW	5	121868492	missense	probably damaging	1.00
R4579:Cux2	UTSW	5	121860653	missense	probably benign	0.01
R4655:Cux2	UTSW	5	121885934	missense	possibly damaging	0.95
R4673:Cux2	UTSW	5	121887476	nonsense	probably null
R4697:Cux2	UTSW	5	121873753	missense	probably damaging	1.00
R4927:Cux2	UTSW	5	121877089	missense	probably benign	0.13
R6208:Cux2	UTSW	5	121860822	missense	possibly damaging	0.93
R6500:Cux2	UTSW	5	121864726	missense	probably benign	0.03
R6661:Cux2	UTSW	5	121869297	missense	probably benign	0.04
R6986:Cux2	UTSW	5	121868579	missense	possibly damaging	0.84
R7296:Cux2	UTSW	5	121861256	missense	probably benign	0.25
R7561:Cux2	UTSW	5	121879868	missense	probably benign	0.31
R7702:Cux2	UTSW	5	121868585	missense	possibly damaging	0.70
R7705:Cux2	UTSW	5	121869673	missense	probably benign	0.13
R7791:Cux2	UTSW	5	121867099	missense	probably benign	0.10
R7998:Cux2	UTSW	5	121868585	missense	possibly damaging	0.70
R8081:Cux2	UTSW	5	121869456	missense	probably benign	0.13
R8096:Cux2	UTSW	5	121869097	missense	possibly damaging	0.70
R8191:Cux2	UTSW	5	121874154	missense	probably benign	0.31
X0027:Cux2	UTSW	5	121884751	missense	probably benign	0.13
Z1176:Cux2	UTSW	5	121873813	nonsense	probably null
Z1176:Cux2	UTSW	5	121885934	missense	probably benign	0.02
Z1177:Cux2	UTSW	5	121873680	missense	probably damaging	1.00
Z1177:Cux2	UTSW	5	121877129	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TATCTGGATTGTTGCCAGCCAG -3'
(R):5'- TCTGTGTCACTGACTGTCCAG -3'

Sequencing Primer
(F):5'- TGCCAGCCAGGGGTCTTTG -3'
(R):5'- ACTGACTGTCCAGTGCCTG -3'

Posted On

2016-08-04