Mutagenetix > Incidental Mutations

Incidental Mutation 'R0486:Rnf20'

42273

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

MMRRC Submission

038685-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0486 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 49645907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 332 (L332I)

Ref Sequence

ENSEMBL: ENSMUSP00000118293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

probably benign
Transcript: ENSMUST00000029989
AA Change: L332I

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: L332I

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126675

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131962

Predicted Effect

probably benign
Transcript: ENSMUST00000146547

SMART Domains

Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149862

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156314
AA Change: L332I

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: L332I

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167496
AA Change: L332I

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: L332I

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Meta Mutation Damage Score

0.0611

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco1	T	C	4: 40,177,783	L268P	probably damaging	Het
Adam22	A	T	5: 8,330,048	H83Q	probably damaging	Het
Anln	T	C	9: 22,352,826	D886G	probably benign	Het
Arhgef11	T	A	3: 87,688,852		probably null	Het
Arl8b	A	T	6: 108,815,326	D116V	possibly damaging	Het
BC051665	C	T	13: 60,784,045	G180D	probably damaging	Het
Bloc1s2	A	G	19: 44,143,150		probably benign	Het
Ccdc185	T	G	1: 182,747,859	S422R	possibly damaging	Het
Cd101	T	C	3: 101,008,092	K720E	possibly damaging	Het
Cdh23	C	A	10: 60,386,946	A1236S	probably damaging	Het
Chd1	G	A	17: 15,734,342	A491T	probably damaging	Het
Chdh	T	C	14: 30,032,858	V275A	possibly damaging	Het
Cmtm2b	A	T	8: 104,330,415	I136F	probably damaging	Het
Cps1	T	C	1: 67,165,392	V457A	probably damaging	Het
Cwf19l1	A	G	19: 44,114,690	V362A	probably benign	Het
Cyp4f17	T	C	17: 32,524,823		probably benign	Het
Cyp4f18	C	A	8: 71,996,017	V263L	probably benign	Het
Dclre1a	A	G	19: 56,541,490		probably benign	Het
Dpp6	T	C	5: 27,661,642	I446T	probably benign	Het
F11r	T	C	1: 171,460,588	W61R	probably damaging	Het
Fam120b	C	T	17: 15,426,288		probably benign	Het
Fastkd2	T	C	1: 63,752,340	V669A	possibly damaging	Het
Foxg1	T	C	12: 49,384,531		probably benign	Het
Foxo3	A	G	10: 42,197,481	Y347H	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gbp7	C	A	3: 142,546,317		probably benign	Het
Glipr1	T	C	10: 111,996,849		probably benign	Het
Gm11555	A	G	11: 99,650,160	S8P	unknown	Het
H6pd	G	A	4: 149,982,936		probably benign	Het
Haus8	C	A	8: 71,256,537	G76W	probably damaging	Het
Haus8	C	T	8: 71,256,538	M75I	probably benign	Het
Kcnj13	C	A	1: 87,387,030	V157L	probably damaging	Het
Kcnt2	T	A	1: 140,509,480	C550*	probably null	Het
Kdm5d	A	G	Y: 927,107	N615S	probably damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ncapd2	G	A	6: 125,184,027	R292*	probably null	Het
Ngef	T	A	1: 87,479,126	N640I	probably damaging	Het
Nhlrc3	T	C	3: 53,452,437	Y335C	probably damaging	Het
Nipbl	A	T	15: 8,338,870		probably benign	Het
Nop2	A	G	6: 125,140,673	K434R	probably null	Het
Nr4a3	T	C	4: 48,056,525		probably benign	Het
Olfr881	A	G	9: 37,992,702	N70S	possibly damaging	Het
Piezo2	A	C	18: 63,029,061	I2233R	probably damaging	Het
Prag1	A	T	8: 36,146,633	E1113V	probably damaging	Het
Prpsap2	A	G	11: 61,741,000	I177T	possibly damaging	Het
Psmd1	T	A	1: 86,094,290	N611K	probably damaging	Het
Ptpn7	C	T	1: 135,137,358	T168I	probably damaging	Het
Pus1	A	T	5: 110,779,730	V53E	probably damaging	Het
Rgs22	A	G	15: 36,092,882	M415T	probably damaging	Het
Rnf165	T	A	18: 77,484,254	Q91L	probably damaging	Het
Rnf17	C	T	14: 56,514,175	T1490M	probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spam1	A	T	6: 24,796,395	Q115L	probably damaging	Het
Syce1l	A	T	8: 113,654,763		probably null	Het
Synj1	T	C	16: 90,938,263		probably benign	Het
Tas2r126	A	T	6: 42,435,291	I253F	probably benign	Het
Tecpr2	G	A	12: 110,896,369	V72I	probably benign	Het
Tfap2a	G	T	13: 40,728,694	P45Q	probably damaging	Het
Trip12	C	A	1: 84,761,084	G714*	probably null	Het
Wdr31	A	G	4: 62,453,893	S330P	probably damaging	Het
Wdr64	T	C	1: 175,795,203		probably benign	Het
Yes1	T	A	5: 32,655,582	Y343*	probably null	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0372:Rnf20	UTSW	4	49650176	missense	possibly damaging	0.53
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R0927:Rnf20	UTSW	4	49642176	missense	probably damaging	1.00
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1460:Rnf20	UTSW	4	49645873	splice site	probably benign
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R2915:Rnf20	UTSW	4	49638769	missense	probably benign	0.13
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R4960:Rnf20	UTSW	4	49638029	missense	probably damaging	0.99
R5022:Rnf20	UTSW	4	49642016	intron	probably benign
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5379:Rnf20	UTSW	4	49652639	missense	possibly damaging	0.47
R5423:Rnf20	UTSW	4	49644620	missense	probably damaging	0.99
R6297:Rnf20	UTSW	4	49642132	missense	probably damaging	1.00
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7064:Rnf20	UTSW	4	49644580	nonsense	probably null
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
R8995:Rnf20	UTSW	4	49648437	missense	possibly damaging	0.94
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGAGCGGGGAGCAGTCTCTATG -3'
(R):5'- TGCAGGTTCACAAGTTGATGAACAAATC -3'

Sequencing Primer
(F):5'- CCGGAAGGTAACATTTGCTC -3'
(R):5'- CAAATCATTTGTCCTTCAGAGCTG -3'

Posted On

2013-05-23