Incidental Mutation 'R5348:Chn2'
ID 422731
Institutional Source Beutler Lab
Gene Symbol Chn2
Ensembl Gene ENSMUSG00000004633
Gene Name chimerin 2
Synonyms 1700026N20Rik, 4930557O16Rik
MMRRC Submission 042927-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.167) question?
Stock # R5348 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 54016917-54278797 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54277203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 279 (I279V)
Ref Sequence ENSEMBL: ENSMUSP00000145231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046856] [ENSMUST00000067741] [ENSMUST00000114401] [ENSMUST00000114402] [ENSMUST00000146114] [ENSMUST00000204746] [ENSMUST00000204115] [ENSMUST00000204921] [ENSMUST00000203941] [ENSMUST00000203091]
AlphaFold Q80XD1
Predicted Effect probably damaging
Transcript: ENSMUST00000046856
AA Change: I461V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035908
Gene: ENSMUSG00000004633
AA Change: I461V

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SH2 57 136 7.23e-16 SMART
C1 215 264 1.88e-15 SMART
RhoGAP 288 465 2.73e-73 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000067741
AA Change: I325V

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066078
Gene: ENSMUSG00000004633
AA Change: I325V

DomainStartEndE-ValueType
C1 79 128 1.88e-15 SMART
RhoGAP 152 329 2.73e-73 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114401
AA Change: I270V

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110043
Gene: ENSMUSG00000004633
AA Change: I270V

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 274 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114402
SMART Domains Protein: ENSMUSP00000110044
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 224 2.07e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145111
Predicted Effect probably damaging
Transcript: ENSMUST00000146114
AA Change: I275V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114476
Gene: ENSMUSG00000004633
AA Change: I275V

DomainStartEndE-ValueType
C1 29 78 1.88e-15 SMART
RhoGAP 102 279 2.73e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185712
Predicted Effect probably benign
Transcript: ENSMUST00000204746
AA Change: I267V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144983
Gene: ENSMUSG00000004633
AA Change: I267V

DomainStartEndE-ValueType
RhoGAP 101 271 4.7e-61 SMART
Predicted Effect unknown
Transcript: ENSMUST00000204115
AA Change: I253V
SMART Domains Protein: ENSMUSP00000145507
Gene: ENSMUSG00000004633
AA Change: I253V

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 101 257 3.7e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204921
AA Change: I279V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145231
Gene: ENSMUSG00000004633
AA Change: I279V

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 152 283 4.9e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203941
AA Change: I221V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000145314
Gene: ENSMUSG00000004633
AA Change: I221V

DomainStartEndE-ValueType
RhoGAP 101 225 1.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203091
SMART Domains Protein: ENSMUSP00000145008
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
Pfam:RhoGAP 155 196 5e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired infrapyramidal tract neuron prunning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,978,634 (GRCm39) C275S possibly damaging Het
Bltp1 A G 3: 37,102,295 (GRCm39) E1331G probably damaging Het
Cdk12 T A 11: 98,095,118 (GRCm39) S309T probably benign Het
Cep295nl T C 11: 118,224,425 (GRCm39) R140G probably damaging Het
Chd8 A G 14: 52,470,155 (GRCm39) V485A probably damaging Het
Cux2 A G 5: 122,004,041 (GRCm39) S1032P probably damaging Het
Ddx55 T A 5: 124,692,628 (GRCm39) M44K probably damaging Het
Dpyd T A 3: 118,575,592 (GRCm39) H143Q probably benign Het
Fbxo10 A G 4: 45,058,934 (GRCm39) W268R probably damaging Het
Gmfg A G 7: 28,145,819 (GRCm39) D86G probably benign Het
Gpd1 T C 15: 99,620,021 (GRCm39) V273A possibly damaging Het
Grhpr T C 4: 44,985,393 (GRCm39) I158T probably damaging Het
Itpr2 A G 6: 146,378,191 (GRCm39) F53L possibly damaging Het
Kctd21 A G 7: 96,997,177 (GRCm39) I217V probably benign Het
Lrfn2 A G 17: 49,403,718 (GRCm39) T614A probably benign Het
Lrrc7 T A 3: 157,880,963 (GRCm39) D491V probably benign Het
Myo7b T C 18: 32,116,972 (GRCm39) E916G probably damaging Het
Nf1 C T 11: 79,455,725 (GRCm39) T550I probably damaging Het
Nsd1 A G 13: 55,460,147 (GRCm39) T2125A probably benign Het
Olfml2b A G 1: 170,489,995 (GRCm39) E205G probably benign Het
Or8k37 A T 2: 86,469,150 (GRCm39) L301I probably benign Het
Papolb T C 5: 142,514,972 (GRCm39) T224A possibly damaging Het
Pcnx2 T C 8: 126,545,495 (GRCm39) E1172G probably damaging Het
Ppip5k2 A G 1: 97,675,317 (GRCm39) L362S possibly damaging Het
Ppp1r9b T A 11: 94,887,438 (GRCm39) Y59* probably null Het
Pramel12 T C 4: 143,143,351 (GRCm39) L39P probably damaging Het
Rapgef5 T A 12: 117,652,346 (GRCm39) S76R probably benign Het
Rnh1 A T 7: 140,743,321 (GRCm39) V218D probably damaging Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Slc4a7 G T 14: 14,786,310 (GRCm38) V999L probably benign Het
Slco4c1 A T 1: 96,770,254 (GRCm39) I270N probably damaging Het
Tdp1 A G 12: 99,881,765 (GRCm39) Y498C probably damaging Het
Tfip11 A G 5: 112,483,534 (GRCm39) S650G probably benign Het
Ttn T C 2: 76,608,638 (GRCm39) T17793A possibly damaging Het
Ulk2 T C 11: 61,674,439 (GRCm39) T856A probably benign Het
Vps13d C T 4: 144,792,459 (GRCm39) G3726E probably damaging Het
Other mutations in Chn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chn2 APN 6 54,272,907 (GRCm39) critical splice donor site probably null
IGL02158:Chn2 APN 6 54,277,230 (GRCm39) unclassified probably benign
IGL02618:Chn2 APN 6 54,197,422 (GRCm39) missense probably damaging 1.00
IGL02807:Chn2 APN 6 54,272,898 (GRCm39) missense possibly damaging 0.80
IGL03357:Chn2 APN 6 54,171,062 (GRCm39) missense probably benign 0.02
R0002:Chn2 UTSW 6 54,250,098 (GRCm39) missense probably benign 0.08
R0123:Chn2 UTSW 6 54,267,436 (GRCm39) splice site probably benign
R0225:Chn2 UTSW 6 54,267,436 (GRCm39) splice site probably benign
R1478:Chn2 UTSW 6 54,270,065 (GRCm39) missense probably damaging 1.00
R1905:Chn2 UTSW 6 54,263,106 (GRCm39) missense probably damaging 1.00
R3769:Chn2 UTSW 6 54,267,396 (GRCm39) missense probably damaging 1.00
R3946:Chn2 UTSW 6 54,246,411 (GRCm39) unclassified probably benign
R4125:Chn2 UTSW 6 54,249,963 (GRCm39) missense probably damaging 1.00
R4127:Chn2 UTSW 6 54,249,963 (GRCm39) missense probably damaging 1.00
R4128:Chn2 UTSW 6 54,249,963 (GRCm39) missense probably damaging 1.00
R4614:Chn2 UTSW 6 54,267,388 (GRCm39) missense probably damaging 1.00
R4616:Chn2 UTSW 6 54,267,388 (GRCm39) missense probably damaging 1.00
R5063:Chn2 UTSW 6 54,267,272 (GRCm39) nonsense probably null
R5121:Chn2 UTSW 6 54,195,546 (GRCm39) missense possibly damaging 0.57
R5208:Chn2 UTSW 6 54,272,786 (GRCm39) missense probably damaging 0.97
R5240:Chn2 UTSW 6 54,197,680 (GRCm39) missense probably benign
R5861:Chn2 UTSW 6 54,267,359 (GRCm39) missense probably damaging 1.00
R6539:Chn2 UTSW 6 54,150,446 (GRCm39) splice site probably null
R6824:Chn2 UTSW 6 54,249,938 (GRCm39) missense probably benign 0.00
R7194:Chn2 UTSW 6 54,263,162 (GRCm39) splice site probably null
R7740:Chn2 UTSW 6 54,277,156 (GRCm39) missense probably benign 0.18
R7765:Chn2 UTSW 6 54,275,137 (GRCm39) critical splice donor site probably null
R7997:Chn2 UTSW 6 54,267,270 (GRCm39) missense probably damaging 1.00
R8477:Chn2 UTSW 6 54,246,467 (GRCm39) splice site probably null
R8804:Chn2 UTSW 6 54,250,061 (GRCm39) missense probably benign 0.01
R9297:Chn2 UTSW 6 54,272,840 (GRCm39) missense probably damaging 1.00
R9318:Chn2 UTSW 6 54,272,840 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCCGCCTGAGGTCTCTG -3'
(R):5'- GGTGGGAAATGCATACTGTACC -3'

Sequencing Primer
(F):5'- GTGCTTGCCTTCCAGGGTTAC -3'
(R):5'- CCACTAGCTCTATCAGCT -3'
Posted On 2016-08-04