Incidental Mutation 'R5348:Rnh1'
ID422736
Institutional Source Beutler Lab
Gene Symbol Rnh1
Ensembl Gene ENSMUSG00000038650
Gene Nameribonuclease/angiogenin inhibitor 1
SynonymsRNH
MMRRC Submission 042927-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5348 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141160326-141172857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141163408 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 218 (V218D)
Ref Sequence ENSEMBL: ENSMUSP00000147928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106033] [ENSMUST00000167493] [ENSMUST00000209378] [ENSMUST00000210314] [ENSMUST00000210979]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106033
AA Change: V182D

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101651
Gene: ENSMUSG00000038650
AA Change: V182D

DomainStartEndE-ValueType
Blast:LRR 22 49 3e-7 BLAST
LRR 50 77 2.95e-3 SMART
LRR 79 106 1.95e-3 SMART
LRR_RI 107 134 1.36e-7 SMART
LRR 136 163 7.15e-2 SMART
LRR 164 191 2.65e-5 SMART
LRR 193 220 4.24e-1 SMART
LRR 221 248 4.94e-5 SMART
LRR 250 277 2.34e-6 SMART
LRR 278 305 1.15e-5 SMART
LRR 307 334 8e0 SMART
LRR 335 362 4.75e-7 SMART
LRR 364 391 1.12e-3 SMART
LRR 392 419 6.17e-6 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167493
AA Change: V182D

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133061
Gene: ENSMUSG00000038650
AA Change: V182D

DomainStartEndE-ValueType
Blast:LRR 22 49 3e-7 BLAST
LRR 50 77 2.95e-3 SMART
LRR 79 106 1.95e-3 SMART
LRR_RI 107 134 1.36e-7 SMART
LRR 136 163 7.15e-2 SMART
LRR 164 191 2.65e-5 SMART
LRR 193 220 4.24e-1 SMART
LRR 221 248 4.94e-5 SMART
LRR 250 277 2.34e-6 SMART
LRR 278 305 1.15e-5 SMART
LRR 307 334 8e0 SMART
LRR 335 362 4.75e-7 SMART
LRR 364 391 1.12e-3 SMART
LRR 392 419 6.17e-6 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209378
AA Change: V182D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210314
AA Change: V218D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000210979
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Placental ribonuclease inhibitor (PRI) is a member of a family of proteinaceous cytoplasmic RNase inhibitors that occur in many tissues and bind to both intracellular and extracellular RNases (summarized by Lee et al., 1988 [PubMed 3219362]). In addition to control of intracellular RNases, the inhibitor may have a role in the regulation of angiogenin (MIM 105850). Ribonuclease inhibitor, of 50,000 Da, binds to ribonucleases and holds them in a latent form. Since neutral and alkaline ribonucleases probably play a critical role in the turnover of RNA in eukaryotic cells, RNH may be essential for control of mRNA turnover; the interaction of eukaryotic cells with ribonuclease may be reversible in vivo.[supplied by OMIM, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,048,146 E1331G probably damaging Het
Abcg5 A T 17: 84,671,206 C275S possibly damaging Het
Cdk12 T A 11: 98,204,292 S309T probably benign Het
Cep295nl T C 11: 118,333,599 R140G probably damaging Het
Chd8 A G 14: 52,232,698 V485A probably damaging Het
Chn2 A G 6: 54,300,218 I279V probably damaging Het
Cux2 A G 5: 121,865,978 S1032P probably damaging Het
Ddx55 T A 5: 124,554,565 M44K probably damaging Het
Dpyd T A 3: 118,781,943 H143Q probably benign Het
Fbxo10 A G 4: 45,058,934 W268R probably damaging Het
Gmfg A G 7: 28,446,394 D86G probably benign Het
Gpd1 T C 15: 99,722,140 V273A possibly damaging Het
Grhpr T C 4: 44,985,393 I158T probably damaging Het
Itpr2 A G 6: 146,476,693 F53L possibly damaging Het
Kctd21 A G 7: 97,347,970 I217V probably benign Het
Lrfn2 A G 17: 49,096,690 T614A probably benign Het
Lrrc7 T A 3: 158,175,326 D491V probably benign Het
Myo7b T C 18: 31,983,919 E916G probably damaging Het
Nf1 C T 11: 79,564,899 T550I probably damaging Het
Nsd1 A G 13: 55,312,334 T2125A probably benign Het
Olfml2b A G 1: 170,662,426 E205G probably benign Het
Olfr1084 A T 2: 86,638,806 L301I probably benign Het
Papolb T C 5: 142,529,217 T224A possibly damaging Het
Pcnx2 T C 8: 125,818,756 E1172G probably damaging Het
Ppip5k2 A G 1: 97,747,592 L362S possibly damaging Het
Ppp1r9b T A 11: 94,996,612 Y59* probably null Het
Pramef8 T C 4: 143,416,781 L39P probably damaging Het
Rapgef5 T A 12: 117,688,611 S76R probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc4a7 G T 14: 14,786,310 V999L probably benign Het
Slco4c1 A T 1: 96,842,529 I270N probably damaging Het
Tdp1 A G 12: 99,915,506 Y498C probably damaging Het
Tfip11 A G 5: 112,335,668 S650G probably benign Het
Ttn T C 2: 76,778,294 T17793A possibly damaging Het
Ulk2 T C 11: 61,783,613 T856A probably benign Het
Vps13d C T 4: 145,065,889 G3726E probably damaging Het
Other mutations in Rnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Rnh1 APN 7 141166731 missense possibly damaging 0.49
IGL01016:Rnh1 APN 7 141164496 splice site probably benign
IGL03156:Rnh1 APN 7 141163183 missense probably damaging 1.00
R0063:Rnh1 UTSW 7 141164196 splice site probably null
R0456:Rnh1 UTSW 7 141162548 missense possibly damaging 0.90
R1086:Rnh1 UTSW 7 141163369 missense probably benign
R1223:Rnh1 UTSW 7 141163207 missense probably damaging 1.00
R1741:Rnh1 UTSW 7 141164023 missense probably benign 0.00
R1771:Rnh1 UTSW 7 141164606 missense possibly damaging 0.55
R4508:Rnh1 UTSW 7 141164543 missense possibly damaging 0.90
R5581:Rnh1 UTSW 7 141163381 missense probably benign 0.00
R6752:Rnh1 UTSW 7 141163441 missense probably benign 0.00
R6932:Rnh1 UTSW 7 141163183 missense probably damaging 1.00
R7536:Rnh1 UTSW 7 141160812 missense possibly damaging 0.92
R8152:Rnh1 UTSW 7 141160704 missense probably damaging 1.00
R8334:Rnh1 UTSW 7 141168631 missense probably benign 0.01
R8791:Rnh1 UTSW 7 141162433 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GTTGCTGCTCAAGTCCAGTTC -3'
(R):5'- ACGTCTCCCTGATACTGCAC -3'

Sequencing Primer
(F):5'- TCAAGTCCAGTTCCTGTAGCGAAG -3'
(R):5'- GATACTGCACTTCTAGACCTATCC -3'
Posted On2016-08-04