Incidental Mutation 'R0486:Snrnp40'
ID 42275
Institutional Source Beutler Lab
Gene Symbol Snrnp40
Ensembl Gene ENSMUSG00000074088
Gene Name small nuclear ribonucleoprotein 40 (U5)
Synonyms 0610009C03Rik, Wdr57
MMRRC Submission 038685-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0486 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 130360132-130390026 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to G at 130378043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105994]
AlphaFold Q6PE01
Predicted Effect probably null
Transcript: ENSMUST00000105994
SMART Domains Protein: ENSMUSP00000101616
Gene: ENSMUSG00000074088

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
WD40 56 95 1.64e-9 SMART
WD40 99 138 1.83e-7 SMART
WD40 141 181 8.68e-9 SMART
WD40 184 222 3.81e-5 SMART
WD40 225 264 3.24e-8 SMART
WD40 271 314 5.1e-6 SMART
WD40 317 356 2.84e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180577
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the U5 small nuclear ribonucleoprotein (snRNP) particle. The U5 snRNP is part of the spliceosome, a multiprotein complex that catalyzes the removal of introns from pre-messenger RNAs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 T C 4: 40,177,783 L268P probably damaging Het
Adam22 A T 5: 8,330,048 H83Q probably damaging Het
Anln T C 9: 22,352,826 D886G probably benign Het
Arhgef11 T A 3: 87,688,852 probably null Het
Arl8b A T 6: 108,815,326 D116V possibly damaging Het
BC051665 C T 13: 60,784,045 G180D probably damaging Het
Bloc1s2 A G 19: 44,143,150 probably benign Het
Ccdc185 T G 1: 182,747,859 S422R possibly damaging Het
Cd101 T C 3: 101,008,092 K720E possibly damaging Het
Cdh23 C A 10: 60,386,946 A1236S probably damaging Het
Chd1 G A 17: 15,734,342 A491T probably damaging Het
Chdh T C 14: 30,032,858 V275A possibly damaging Het
Cmtm2b A T 8: 104,330,415 I136F probably damaging Het
Cps1 T C 1: 67,165,392 V457A probably damaging Het
Cwf19l1 A G 19: 44,114,690 V362A probably benign Het
Cyp4f17 T C 17: 32,524,823 probably benign Het
Cyp4f18 C A 8: 71,996,017 V263L probably benign Het
Dclre1a A G 19: 56,541,490 probably benign Het
Dpp6 T C 5: 27,661,642 I446T probably benign Het
F11r T C 1: 171,460,588 W61R probably damaging Het
Fam120b C T 17: 15,426,288 probably benign Het
Fastkd2 T C 1: 63,752,340 V669A possibly damaging Het
Foxg1 T C 12: 49,384,531 probably benign Het
Foxo3 A G 10: 42,197,481 Y347H probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gbp7 C A 3: 142,546,317 probably benign Het
Glipr1 T C 10: 111,996,849 probably benign Het
Gm11555 A G 11: 99,650,160 S8P unknown Het
H6pd G A 4: 149,982,936 probably benign Het
Haus8 C A 8: 71,256,537 G76W probably damaging Het
Haus8 C T 8: 71,256,538 M75I probably benign Het
Kcnj13 C A 1: 87,387,030 V157L probably damaging Het
Kcnt2 T A 1: 140,509,480 C550* probably null Het
Kdm5d A G Y: 927,107 N615S probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Ngef T A 1: 87,479,126 N640I probably damaging Het
Nhlrc3 T C 3: 53,452,437 Y335C probably damaging Het
Nipbl A T 15: 8,338,870 probably benign Het
Nop2 A G 6: 125,140,673 K434R probably null Het
Nr4a3 T C 4: 48,056,525 probably benign Het
Olfr881 A G 9: 37,992,702 N70S possibly damaging Het
Piezo2 A C 18: 63,029,061 I2233R probably damaging Het
Prag1 A T 8: 36,146,633 E1113V probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Psmd1 T A 1: 86,094,290 N611K probably damaging Het
Ptpn7 C T 1: 135,137,358 T168I probably damaging Het
Pus1 A T 5: 110,779,730 V53E probably damaging Het
Rgs22 A G 15: 36,092,882 M415T probably damaging Het
Rnf165 T A 18: 77,484,254 Q91L probably damaging Het
Rnf17 C T 14: 56,514,175 T1490M probably benign Het
Rnf20 C A 4: 49,645,907 L332I possibly damaging Het
Spam1 A T 6: 24,796,395 Q115L probably damaging Het
Syce1l A T 8: 113,654,763 probably null Het
Synj1 T C 16: 90,938,263 probably benign Het
Tas2r126 A T 6: 42,435,291 I253F probably benign Het
Tecpr2 G A 12: 110,896,369 V72I probably benign Het
Tfap2a G T 13: 40,728,694 P45Q probably damaging Het
Trip12 C A 1: 84,761,084 G714* probably null Het
Wdr31 A G 4: 62,453,893 S330P probably damaging Het
Wdr64 T C 1: 175,795,203 probably benign Het
Yes1 T A 5: 32,655,582 Y343* probably null Het
Other mutations in Snrnp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Snrnp40 APN 4 130360221 missense probably damaging 0.99
IGL02306:Snrnp40 APN 4 130365100 missense probably benign 0.21
skywarp UTSW 4 130378043 splice site probably null
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0077:Snrnp40 UTSW 4 130378043 splice site probably null
R0134:Snrnp40 UTSW 4 130378043 splice site probably null
R0211:Snrnp40 UTSW 4 130378043 splice site probably null
R0349:Snrnp40 UTSW 4 130378043 splice site probably null
R0371:Snrnp40 UTSW 4 130378043 splice site probably null
R0372:Snrnp40 UTSW 4 130378043 splice site probably null
R0376:Snrnp40 UTSW 4 130378043 splice site probably null
R0377:Snrnp40 UTSW 4 130378043 splice site probably null
R0400:Snrnp40 UTSW 4 130362650 missense probably damaging 1.00
R0442:Snrnp40 UTSW 4 130378043 splice site probably null
R0443:Snrnp40 UTSW 4 130378043 splice site probably null
R0488:Snrnp40 UTSW 4 130378043 splice site probably null
R0568:Snrnp40 UTSW 4 130378043 splice site probably null
R0624:Snrnp40 UTSW 4 130362658 missense probably damaging 0.98
R0632:Snrnp40 UTSW 4 130378043 splice site probably null
R0650:Snrnp40 UTSW 4 130378043 splice site probably null
R0733:Snrnp40 UTSW 4 130378043 splice site probably null
R1161:Snrnp40 UTSW 4 130378043 splice site probably null
R1182:Snrnp40 UTSW 4 130378043 splice site probably null
R1234:Snrnp40 UTSW 4 130378043 splice site probably null
R1236:Snrnp40 UTSW 4 130378043 splice site probably null
R1305:Snrnp40 UTSW 4 130378043 splice site probably null
R1308:Snrnp40 UTSW 4 130378043 splice site probably null
R1333:Snrnp40 UTSW 4 130378043 splice site probably null
R1413:Snrnp40 UTSW 4 130378043 splice site probably null
R1569:Snrnp40 UTSW 4 130378043 splice site probably null
R1616:Snrnp40 UTSW 4 130378043 splice site probably null
R1656:Snrnp40 UTSW 4 130378043 splice site probably null
R1675:Snrnp40 UTSW 4 130378043 splice site probably null
R1759:Snrnp40 UTSW 4 130378043 splice site probably null
R1856:Snrnp40 UTSW 4 130378043 splice site probably null
R1901:Snrnp40 UTSW 4 130385975 missense probably damaging 0.98
R1912:Snrnp40 UTSW 4 130378043 splice site probably null
R1930:Snrnp40 UTSW 4 130378043 splice site probably null
R1931:Snrnp40 UTSW 4 130378043 splice site probably null
R2435:Snrnp40 UTSW 4 130384551 missense probably damaging 1.00
R3722:Snrnp40 UTSW 4 130368275 missense possibly damaging 0.76
R4782:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R4799:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R5075:Snrnp40 UTSW 4 130388582 missense probably benign 0.07
R5104:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R5369:Snrnp40 UTSW 4 130362646 missense probably damaging 0.97
R5699:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R7529:Snrnp40 UTSW 4 130384482 missense possibly damaging 0.94
R8264:Snrnp40 UTSW 4 130378074 missense probably benign 0.00
R8412:Snrnp40 UTSW 4 130384523 missense possibly damaging 0.49
R9319:Snrnp40 UTSW 4 130362752 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACATGGTCCTCTTTCTTGAACAACCAG -3'
(R):5'- GCATTAAGTGCCAACCTCCTGCAATC -3'

Sequencing Primer
(F):5'- GAAACCAGAAGAGGGAGTCAG -3'
(R):5'- TCCTGCAATCTCAACATTTAAAAAAG -3'
Posted On 2013-05-23