Incidental Mutation 'R5348:Chd8'
ID422750
Institutional Source Beutler Lab
Gene Symbol Chd8
Ensembl Gene ENSMUSG00000053754
Gene Namechromodomain helicase DNA binding protein 8
SynonymsDuplin, 5830451P18Rik
MMRRC Submission 042927-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5348 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location52198151-52257780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52232698 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 485 (V485A)
Ref Sequence ENSEMBL: ENSMUSP00000142890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000226307]
Predicted Effect probably damaging
Transcript: ENSMUST00000089752
AA Change: V485A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: V485A

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: V220A

DomainStartEndE-ValueType
low complexity region 74 93 N/A INTRINSIC
Blast:DEXDc 112 235 9e-40 BLAST
low complexity region 239 250 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
low complexity region 430 445 N/A INTRINSIC
Blast:SANT 456 515 1e-29 BLAST
low complexity region 547 563 N/A INTRINSIC
low complexity region 723 767 N/A INTRINSIC
low complexity region 882 899 N/A INTRINSIC
BRK 972 1016 1.34e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200169
AA Change: V485A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: V485A

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226307
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,048,146 E1331G probably damaging Het
Abcg5 A T 17: 84,671,206 C275S possibly damaging Het
Cdk12 T A 11: 98,204,292 S309T probably benign Het
Cep295nl T C 11: 118,333,599 R140G probably damaging Het
Chn2 A G 6: 54,300,218 I279V probably damaging Het
Cux2 A G 5: 121,865,978 S1032P probably damaging Het
Ddx55 T A 5: 124,554,565 M44K probably damaging Het
Dpyd T A 3: 118,781,943 H143Q probably benign Het
Fbxo10 A G 4: 45,058,934 W268R probably damaging Het
Gmfg A G 7: 28,446,394 D86G probably benign Het
Gpd1 T C 15: 99,722,140 V273A possibly damaging Het
Grhpr T C 4: 44,985,393 I158T probably damaging Het
Itpr2 A G 6: 146,476,693 F53L possibly damaging Het
Kctd21 A G 7: 97,347,970 I217V probably benign Het
Lrfn2 A G 17: 49,096,690 T614A probably benign Het
Lrrc7 T A 3: 158,175,326 D491V probably benign Het
Myo7b T C 18: 31,983,919 E916G probably damaging Het
Nf1 C T 11: 79,564,899 T550I probably damaging Het
Nsd1 A G 13: 55,312,334 T2125A probably benign Het
Olfml2b A G 1: 170,662,426 E205G probably benign Het
Olfr1084 A T 2: 86,638,806 L301I probably benign Het
Papolb T C 5: 142,529,217 T224A possibly damaging Het
Pcnx2 T C 8: 125,818,756 E1172G probably damaging Het
Ppip5k2 A G 1: 97,747,592 L362S possibly damaging Het
Ppp1r9b T A 11: 94,996,612 Y59* probably null Het
Pramef8 T C 4: 143,416,781 L39P probably damaging Het
Rapgef5 T A 12: 117,688,611 S76R probably benign Het
Rnh1 A T 7: 141,163,408 V218D probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc4a7 G T 14: 14,786,310 V999L probably benign Het
Slco4c1 A T 1: 96,842,529 I270N probably damaging Het
Tdp1 A G 12: 99,915,506 Y498C probably damaging Het
Tfip11 A G 5: 112,335,668 S650G probably benign Het
Ttn T C 2: 76,778,294 T17793A possibly damaging Het
Ulk2 T C 11: 61,783,613 T856A probably benign Het
Vps13d C T 4: 145,065,889 G3726E probably damaging Het
Other mutations in Chd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Chd8 APN 14 52226138 missense probably damaging 0.99
IGL00694:Chd8 APN 14 52217970 missense probably damaging 1.00
IGL01011:Chd8 APN 14 52231532 missense possibly damaging 0.86
IGL01022:Chd8 APN 14 52236993 missense probably benign
IGL01066:Chd8 APN 14 52217766 missense probably damaging 1.00
IGL01083:Chd8 APN 14 52221420 missense probably damaging 1.00
IGL01313:Chd8 APN 14 52210575 missense probably damaging 1.00
IGL01396:Chd8 APN 14 52204587 unclassified probably benign
IGL01476:Chd8 APN 14 52205490 missense probably benign 0.32
IGL01731:Chd8 APN 14 52212654 missense probably benign 0.12
IGL01895:Chd8 APN 14 52199094 missense probably benign 0.00
IGL02090:Chd8 APN 14 52227234 critical splice donor site probably null
IGL02344:Chd8 APN 14 52201650 missense probably damaging 1.00
IGL02573:Chd8 APN 14 52219734 missense possibly damaging 0.95
IGL02601:Chd8 APN 14 52214300 missense possibly damaging 0.94
IGL02617:Chd8 APN 14 52235191 missense probably benign 0.34
IGL02873:Chd8 APN 14 52222513 missense probably damaging 0.99
IGL02974:Chd8 APN 14 52201701 splice site probably null
IGL03058:Chd8 APN 14 52218273 missense probably damaging 1.00
IGL03076:Chd8 APN 14 52226162 splice site probably benign
IGL03239:Chd8 APN 14 52227548 missense possibly damaging 0.92
PIT4431001:Chd8 UTSW 14 52218249 missense probably damaging 0.98
PIT4468001:Chd8 UTSW 14 52207996 missense probably benign
PIT4468001:Chd8 UTSW 14 52217881 missense possibly damaging 0.95
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0022:Chd8 UTSW 14 52232855 missense probably benign 0.00
R0115:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0132:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0419:Chd8 UTSW 14 52204060 missense probably benign 0.24
R0440:Chd8 UTSW 14 52204826 missense possibly damaging 0.91
R0452:Chd8 UTSW 14 52214587 missense probably damaging 1.00
R0481:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0624:Chd8 UTSW 14 52219757 missense possibly damaging 0.65
R0650:Chd8 UTSW 14 52202304 missense probably benign 0.09
R0691:Chd8 UTSW 14 52213433 missense probably damaging 0.96
R0790:Chd8 UTSW 14 52204025 missense probably benign 0.07
R0835:Chd8 UTSW 14 52204025 missense probably benign 0.07
R1180:Chd8 UTSW 14 52221108 missense probably damaging 1.00
R1411:Chd8 UTSW 14 52224646 missense probably benign
R1725:Chd8 UTSW 14 52232573 missense probably benign 0.08
R1838:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1839:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1968:Chd8 UTSW 14 52220993 missense probably damaging 0.98
R2020:Chd8 UTSW 14 52215241 missense probably damaging 1.00
R2024:Chd8 UTSW 14 52231493 missense probably benign 0.23
R2139:Chd8 UTSW 14 52236971 missense probably benign 0.32
R2163:Chd8 UTSW 14 52198818 missense possibly damaging 0.53
R2342:Chd8 UTSW 14 52205217 missense probably benign 0.25
R2844:Chd8 UTSW 14 52204495 missense possibly damaging 0.92
R3500:Chd8 UTSW 14 52205653 missense probably benign 0.00
R3861:Chd8 UTSW 14 52237121 missense probably benign 0.13
R4154:Chd8 UTSW 14 52207211 unclassified probably benign
R4445:Chd8 UTSW 14 52204527 splice site probably null
R4628:Chd8 UTSW 14 52206915 missense probably benign 0.03
R4779:Chd8 UTSW 14 52231506 missense probably damaging 1.00
R4783:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R4784:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R5001:Chd8 UTSW 14 52203915 missense probably benign 0.09
R5280:Chd8 UTSW 14 52205125 missense possibly damaging 0.68
R5331:Chd8 UTSW 14 52202114 intron probably benign
R5375:Chd8 UTSW 14 52204154 missense probably damaging 1.00
R5470:Chd8 UTSW 14 52212609 missense probably damaging 1.00
R5479:Chd8 UTSW 14 52215195 missense probably benign 0.15
R5488:Chd8 UTSW 14 52213048 intron probably benign
R5489:Chd8 UTSW 14 52213048 intron probably benign
R5499:Chd8 UTSW 14 52204431 critical splice donor site probably null
R5988:Chd8 UTSW 14 52217938 missense probably damaging 1.00
R6046:Chd8 UTSW 14 52221071 missense possibly damaging 0.60
R6125:Chd8 UTSW 14 52207034 missense probably benign 0.16
R6212:Chd8 UTSW 14 52201698 missense probably damaging 1.00
R6337:Chd8 UTSW 14 52204109 missense probably damaging 1.00
R6394:Chd8 UTSW 14 52202585 missense possibly damaging 0.66
R6576:Chd8 UTSW 14 52216076 missense probably damaging 1.00
R6590:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6690:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6786:Chd8 UTSW 14 52226668 missense probably benign 0.33
R6913:Chd8 UTSW 14 52214494 missense probably damaging 0.99
R7090:Chd8 UTSW 14 52215220 missense probably damaging 0.99
R7107:Chd8 UTSW 14 52212672 missense probably benign 0.07
R7138:Chd8 UTSW 14 52214498 missense possibly damaging 0.83
R7383:Chd8 UTSW 14 52215319 missense probably damaging 1.00
R7392:Chd8 UTSW 14 52232855 missense probably benign
R7471:Chd8 UTSW 14 52204112 missense probably benign
R7625:Chd8 UTSW 14 52237077 missense probably benign 0.04
R7790:Chd8 UTSW 14 52226082 missense probably damaging 1.00
R7862:Chd8 UTSW 14 52214277 missense probably damaging 1.00
R7937:Chd8 UTSW 14 52227506 missense probably benign 0.02
R8092:Chd8 UTSW 14 52217727 missense probably damaging 1.00
R8237:Chd8 UTSW 14 52213352 missense probably damaging 1.00
R8321:Chd8 UTSW 14 52232567 missense probably benign 0.01
R8371:Chd8 UTSW 14 52232818 missense probably benign
R8425:Chd8 UTSW 14 52210555 missense probably damaging 1.00
R8674:Chd8 UTSW 14 52213006 missense probably damaging 0.98
R8794:Chd8 UTSW 14 52204447 missense probably damaging 0.98
R8828:Chd8 UTSW 14 52210580 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCCCGCAGTGTACTGTTCC -3'
(R):5'- TGGTTAAAGTTCTAAGTGCCAGTG -3'

Sequencing Primer
(F):5'- GCAGTGTACTGTTCCCAGCAC -3'
(R):5'- AGTTCTAAGTGCCAGTGAAGTG -3'
Posted On2016-08-04