Mutagenetix > Incidental Mutations

Incidental Mutation 'R5348:Chd8'

422750

Institutional Source

Beutler Lab

Gene Symbol

Chd8

Ensembl Gene

ENSMUSG00000053754

Gene Name

chromodomain helicase DNA binding protein 8

Synonyms

Duplin, 5830451P18Rik

MMRRC Submission

042927-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5348 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52198151-52257780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52232698 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 485 (V485A)

Ref Sequence

ENSEMBL: ENSMUSP00000142890 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000226307]

Predicted Effect

probably damaging
Transcript: ENSMUST00000089752
AA Change: V485A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: V485A

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: V220A

Domain	Start	End	E-Value	Type
low complexity region	74	93	N/A	INTRINSIC
Blast:DEXDc	112	235	9e-40	BLAST
low complexity region	239	250	N/A	INTRINSIC
low complexity region	363	374	N/A	INTRINSIC
low complexity region	430	445	N/A	INTRINSIC
Blast:SANT	456	515	1e-29	BLAST
low complexity region	547	563	N/A	INTRINSIC
low complexity region	723	767	N/A	INTRINSIC
low complexity region	882	899	N/A	INTRINSIC
BRK	972	1016	1.34e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000200169
AA Change: V485A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: V485A

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226307

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 37,048,146	E1331G	probably damaging	Het
Abcg5	A	T	17: 84,671,206	C275S	possibly damaging	Het
Cdk12	T	A	11: 98,204,292	S309T	probably benign	Het
Cep295nl	T	C	11: 118,333,599	R140G	probably damaging	Het
Chn2	A	G	6: 54,300,218	I279V	probably damaging	Het
Cux2	A	G	5: 121,865,978	S1032P	probably damaging	Het
Ddx55	T	A	5: 124,554,565	M44K	probably damaging	Het
Dpyd	T	A	3: 118,781,943	H143Q	probably benign	Het
Fbxo10	A	G	4: 45,058,934	W268R	probably damaging	Het
Gmfg	A	G	7: 28,446,394	D86G	probably benign	Het
Gpd1	T	C	15: 99,722,140	V273A	possibly damaging	Het
Grhpr	T	C	4: 44,985,393	I158T	probably damaging	Het
Itpr2	A	G	6: 146,476,693	F53L	possibly damaging	Het
Kctd21	A	G	7: 97,347,970	I217V	probably benign	Het
Lrfn2	A	G	17: 49,096,690	T614A	probably benign	Het
Lrrc7	T	A	3: 158,175,326	D491V	probably benign	Het
Myo7b	T	C	18: 31,983,919	E916G	probably damaging	Het
Nf1	C	T	11: 79,564,899	T550I	probably damaging	Het
Nsd1	A	G	13: 55,312,334	T2125A	probably benign	Het
Olfml2b	A	G	1: 170,662,426	E205G	probably benign	Het
Olfr1084	A	T	2: 86,638,806	L301I	probably benign	Het
Papolb	T	C	5: 142,529,217	T224A	possibly damaging	Het
Pcnx2	T	C	8: 125,818,756	E1172G	probably damaging	Het
Ppip5k2	A	G	1: 97,747,592	L362S	possibly damaging	Het
Ppp1r9b	T	A	11: 94,996,612	Y59*	probably null	Het
Pramef8	T	C	4: 143,416,781	L39P	probably damaging	Het
Rapgef5	T	A	12: 117,688,611	S76R	probably benign	Het
Rnh1	A	T	7: 141,163,408	V218D	probably damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Slc4a7	G	T	14: 14,786,310	V999L	probably benign	Het
Slco4c1	A	T	1: 96,842,529	I270N	probably damaging	Het
Tdp1	A	G	12: 99,915,506	Y498C	probably damaging	Het
Tfip11	A	G	5: 112,335,668	S650G	probably benign	Het
Ttn	T	C	2: 76,778,294	T17793A	possibly damaging	Het
Ulk2	T	C	11: 61,783,613	T856A	probably benign	Het
Vps13d	C	T	4: 145,065,889	G3726E	probably damaging	Het

Other mutations in Chd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Chd8	APN	14	52226138	missense	probably damaging	0.99
IGL00694:Chd8	APN	14	52217970	missense	probably damaging	1.00
IGL01011:Chd8	APN	14	52231532	missense	possibly damaging	0.86
IGL01022:Chd8	APN	14	52236993	missense	probably benign
IGL01066:Chd8	APN	14	52217766	missense	probably damaging	1.00
IGL01083:Chd8	APN	14	52221420	missense	probably damaging	1.00
IGL01313:Chd8	APN	14	52210575	missense	probably damaging	1.00
IGL01396:Chd8	APN	14	52204587	unclassified	probably benign
IGL01476:Chd8	APN	14	52205490	missense	probably benign	0.32
IGL01731:Chd8	APN	14	52212654	missense	probably benign	0.12
IGL01895:Chd8	APN	14	52199094	missense	probably benign	0.00
IGL02090:Chd8	APN	14	52227234	critical splice donor site	probably null
IGL02344:Chd8	APN	14	52201650	missense	probably damaging	1.00
IGL02573:Chd8	APN	14	52219734	missense	possibly damaging	0.95
IGL02601:Chd8	APN	14	52214300	missense	possibly damaging	0.94
IGL02617:Chd8	APN	14	52235191	missense	probably benign	0.34
IGL02873:Chd8	APN	14	52222513	missense	probably damaging	0.99
IGL02974:Chd8	APN	14	52201701	splice site	probably null
IGL03058:Chd8	APN	14	52218273	missense	probably damaging	1.00
IGL03076:Chd8	APN	14	52226162	splice site	probably benign
IGL03239:Chd8	APN	14	52227548	missense	possibly damaging	0.92
PIT4431001:Chd8	UTSW	14	52218249	missense	probably damaging	0.98
PIT4468001:Chd8	UTSW	14	52207996	missense	probably benign
PIT4468001:Chd8	UTSW	14	52217881	missense	possibly damaging	0.95
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0022:Chd8	UTSW	14	52232855	missense	probably benign	0.00
R0115:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0132:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0419:Chd8	UTSW	14	52204060	missense	probably benign	0.24
R0440:Chd8	UTSW	14	52204826	missense	possibly damaging	0.91
R0452:Chd8	UTSW	14	52214587	missense	probably damaging	1.00
R0481:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0624:Chd8	UTSW	14	52219757	missense	possibly damaging	0.65
R0650:Chd8	UTSW	14	52202304	missense	probably benign	0.09
R0691:Chd8	UTSW	14	52213433	missense	probably damaging	0.96
R0790:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R0835:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R1180:Chd8	UTSW	14	52221108	missense	probably damaging	1.00
R1411:Chd8	UTSW	14	52224646	missense	probably benign
R1725:Chd8	UTSW	14	52232573	missense	probably benign	0.08
R1838:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1839:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1968:Chd8	UTSW	14	52220993	missense	probably damaging	0.98
R2020:Chd8	UTSW	14	52215241	missense	probably damaging	1.00
R2024:Chd8	UTSW	14	52231493	missense	probably benign	0.23
R2139:Chd8	UTSW	14	52236971	missense	probably benign	0.32
R2163:Chd8	UTSW	14	52198818	missense	possibly damaging	0.53
R2342:Chd8	UTSW	14	52205217	missense	probably benign	0.25
R2844:Chd8	UTSW	14	52204495	missense	possibly damaging	0.92
R3500:Chd8	UTSW	14	52205653	missense	probably benign	0.00
R3861:Chd8	UTSW	14	52237121	missense	probably benign	0.13
R4154:Chd8	UTSW	14	52207211	unclassified	probably benign
R4445:Chd8	UTSW	14	52204527	splice site	probably null
R4628:Chd8	UTSW	14	52206915	missense	probably benign	0.03
R4779:Chd8	UTSW	14	52231506	missense	probably damaging	1.00
R4783:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R4784:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R5001:Chd8	UTSW	14	52203915	missense	probably benign	0.09
R5280:Chd8	UTSW	14	52205125	missense	possibly damaging	0.68
R5331:Chd8	UTSW	14	52202114	intron	probably benign
R5375:Chd8	UTSW	14	52204154	missense	probably damaging	1.00
R5470:Chd8	UTSW	14	52212609	missense	probably damaging	1.00
R5479:Chd8	UTSW	14	52215195	missense	probably benign	0.15
R5488:Chd8	UTSW	14	52213048	intron	probably benign
R5489:Chd8	UTSW	14	52213048	intron	probably benign
R5499:Chd8	UTSW	14	52204431	critical splice donor site	probably null
R5988:Chd8	UTSW	14	52217938	missense	probably damaging	1.00
R6046:Chd8	UTSW	14	52221071	missense	possibly damaging	0.60
R6125:Chd8	UTSW	14	52207034	missense	probably benign	0.16
R6212:Chd8	UTSW	14	52201698	missense	probably damaging	1.00
R6337:Chd8	UTSW	14	52204109	missense	probably damaging	1.00
R6394:Chd8	UTSW	14	52202585	missense	possibly damaging	0.66
R6576:Chd8	UTSW	14	52216076	missense	probably damaging	1.00
R6590:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6690:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6786:Chd8	UTSW	14	52226668	missense	probably benign	0.33
R6913:Chd8	UTSW	14	52214494	missense	probably damaging	0.99
R7090:Chd8	UTSW	14	52215220	missense	probably damaging	0.99
R7107:Chd8	UTSW	14	52212672	missense	probably benign	0.07
R7138:Chd8	UTSW	14	52214498	missense	possibly damaging	0.83
R7383:Chd8	UTSW	14	52215319	missense	probably damaging	1.00
R7392:Chd8	UTSW	14	52232855	missense	probably benign
R7471:Chd8	UTSW	14	52204112	missense	probably benign
R7625:Chd8	UTSW	14	52237077	missense	probably benign	0.04
R7790:Chd8	UTSW	14	52226082	missense	probably damaging	1.00
R7862:Chd8	UTSW	14	52214277	missense	probably damaging	1.00
R7937:Chd8	UTSW	14	52227506	missense	probably benign	0.02
R8092:Chd8	UTSW	14	52217727	missense	probably damaging	1.00
R8237:Chd8	UTSW	14	52213352	missense	probably damaging	1.00
R8321:Chd8	UTSW	14	52232567	missense	probably benign	0.01
R8371:Chd8	UTSW	14	52232818	missense	probably benign
R8425:Chd8	UTSW	14	52210555	missense	probably damaging	1.00
R8674:Chd8	UTSW	14	52213006	missense	probably damaging	0.98
R8794:Chd8	UTSW	14	52204447	missense	probably damaging	0.98
R8828:Chd8	UTSW	14	52210580	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ATCCCGCAGTGTACTGTTCC -3'
(R):5'- TGGTTAAAGTTCTAAGTGCCAGTG -3'

Sequencing Primer
(F):5'- GCAGTGTACTGTTCCCAGCAC -3'
(R):5'- AGTTCTAAGTGCCAGTGAAGTG -3'

Posted On

2016-08-04