Incidental Mutation 'R5349:Cnst'
ID422755
Institutional Source Beutler Lab
Gene Symbol Cnst
Ensembl Gene ENSMUSG00000038949
Gene Nameconsortin, connexin sorting protein
Synonyms
MMRRC Submission 042928-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5349 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location179546370-179627478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 179622897 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 642 (E642G)
Ref Sequence ENSEMBL: ENSMUSP00000048205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040706]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040706
AA Change: E642G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048205
Gene: ENSMUSG00000038949
AA Change: E642G

DomainStartEndE-ValueType
low complexity region 109 126 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
Pfam:Consortin_C 598 709 3.4e-56 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Targeting of numerous transmembrane proteins to the cell surface is thought to depend on their recognition by cargo receptors that interact with the adaptor machinery for anterograde traffic at the distal end of the Golgi complex. Consortin (CNST) is an integral membrane protein that acts as a binding partner of connexins, the building blocks of gap junctions, and acts as a trans-Golgi network (TGN) receptor involved in connexin targeting to the plasma membrane and recycling from the cell surface (del Castillo et al., 2010 [PubMed 19864490]).[supplied by OMIM, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,867,958 E327G possibly damaging Het
Cd209d T G 8: 3,878,320 M22L probably benign Het
Chrna2 T C 14: 66,143,507 V75A probably damaging Het
Diaph1 A G 18: 37,891,072 V571A unknown Het
Dip2c C A 13: 9,622,653 H1032N probably damaging Het
Fbxl3 T C 14: 103,095,576 probably benign Het
Glb1 T C 9: 114,434,461 probably null Het
Gm8220 T C 14: 44,288,177 I101T probably benign Het
Gm8994 A T 6: 136,329,696 D385V probably damaging Het
Grin2b A G 6: 136,044,283 C7R possibly damaging Het
Myo15 T C 11: 60,493,583 I516T probably damaging Het
Nr1i3 A G 1: 171,215,072 D89G possibly damaging Het
Ogfod1 T G 8: 94,055,248 probably benign Het
Olfr730 G T 14: 50,186,773 S148* probably null Het
Pard3 G T 8: 127,415,743 D930Y probably damaging Het
Pde7b C T 10: 20,619,186 C9Y probably damaging Het
Pilra T A 5: 137,831,226 D192V probably damaging Het
Ptprj A G 2: 90,471,261 S176P probably benign Het
Slc4a2 T C 5: 24,435,635 V685A possibly damaging Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
Stox2 A G 8: 47,287,916 F44L possibly damaging Het
Tlr11 T C 14: 50,360,880 F108L probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A C 2: 76,808,106 I13943M probably damaging Het
Wdfy4 T C 14: 32,988,899 D2577G probably damaging Het
Zyg11a A T 4: 108,183,732 F675I probably damaging Het
Other mutations in Cnst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Cnst APN 1 179624992 splice site probably benign
R0360:Cnst UTSW 1 179579535 missense probably benign 0.00
R1391:Cnst UTSW 1 179579486 missense possibly damaging 0.81
R1743:Cnst UTSW 1 179610392 missense probably benign 0.18
R1909:Cnst UTSW 1 179622791 missense probably damaging 1.00
R3856:Cnst UTSW 1 179579714 missense probably benign 0.02
R4565:Cnst UTSW 1 179604549 missense probably damaging 1.00
R5041:Cnst UTSW 1 179605028 missense probably damaging 0.99
R5072:Cnst UTSW 1 179622886 missense possibly damaging 0.61
R5087:Cnst UTSW 1 179622813 missense possibly damaging 0.82
R5294:Cnst UTSW 1 179610440 missense probably benign 0.03
R5394:Cnst UTSW 1 179601736 splice site probably benign
R6020:Cnst UTSW 1 179609875 missense probably benign
R6198:Cnst UTSW 1 179592865 missense probably damaging 1.00
R6669:Cnst UTSW 1 179605073 splice site probably null
R6767:Cnst UTSW 1 179609954 missense possibly damaging 0.92
R7007:Cnst UTSW 1 179610568 missense probably damaging 1.00
R7179:Cnst UTSW 1 179579382 start gained probably benign
R7356:Cnst UTSW 1 179606530 missense probably benign 0.01
R7730:Cnst UTSW 1 179625085 missense probably damaging 1.00
R7900:Cnst UTSW 1 179622888 missense probably damaging 1.00
R8073:Cnst UTSW 1 179606437 missense probably benign 0.00
R8194:Cnst UTSW 1 179610194 missense probably benign 0.00
Z1088:Cnst UTSW 1 179579565 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATAAGTCCCAGATACGCCC -3'
(R):5'- TCTGGGTTGGTGAGACTACAAAG -3'

Sequencing Primer
(F):5'- GTCCCAGATACGCCCCACAC -3'
(R):5'- GGTGAGACTACAAAGACTATTTTGC -3'
Posted On2016-08-04