Incidental Mutation 'R5349:Zyg11a'
ID422761
Institutional Source Beutler Lab
Gene Symbol Zyg11a
Ensembl Gene ENSMUSG00000034645
Gene Namezyg-11 family member A, cell cycle regulator
Synonyms
MMRRC Submission 042928-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5349 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location108181738-108218048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108183732 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 675 (F675I)
Ref Sequence ENSEMBL: ENSMUSP00000152477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043793] [ENSMUST00000052999] [ENSMUST00000106690] [ENSMUST00000116307] [ENSMUST00000116309] [ENSMUST00000125647] [ENSMUST00000126900] [ENSMUST00000130942] [ENSMUST00000223127]
Predicted Effect probably damaging
Transcript: ENSMUST00000043793
AA Change: F673I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038478
Gene: ENSMUSG00000034645
AA Change: F673I

DomainStartEndE-ValueType
SCOP:d1jdha_ 218 700 2e-11 SMART
Blast:ARM 497 544 1e-5 BLAST
Blast:ARM 547 587 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000052999
SMART Domains Protein: ENSMUSP00000051268
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH_1 41 296 1.1e-60 PFAM
Pfam:ECH_2 46 225 5.1e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106690
AA Change: F675I

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102301
Gene: ENSMUSG00000034645
AA Change: F675I

DomainStartEndE-ValueType
SCOP:d1jdha_ 139 621 1e-11 SMART
Blast:ARM 418 465 1e-5 BLAST
Blast:ARM 468 508 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106691
SMART Domains Protein: ENSMUSP00000102302
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH_1 1 119 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116307
SMART Domains Protein: ENSMUSP00000112009
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH 39 131 6.7e-17 PFAM
Pfam:ECH 124 257 5.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116309
SMART Domains Protein: ENSMUSP00000112011
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH 39 288 3.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125647
SMART Domains Protein: ENSMUSP00000123913
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127392
Predicted Effect probably benign
Transcript: ENSMUST00000130942
SMART Domains Protein: ENSMUSP00000124746
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH 39 103 8.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133049
Predicted Effect probably benign
Transcript: ENSMUST00000135718
SMART Domains Protein: ENSMUSP00000114371
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH_1 1 74 9.6e-16 PFAM
Pfam:ECH_2 2 74 1.1e-11 PFAM
Pfam:ECH_1 69 184 2.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223127
AA Change: F675I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,867,958 E327G possibly damaging Het
Cd209d T G 8: 3,878,320 M22L probably benign Het
Chrna2 T C 14: 66,143,507 V75A probably damaging Het
Cnst A G 1: 179,622,897 E642G possibly damaging Het
Diaph1 A G 18: 37,891,072 V571A unknown Het
Dip2c C A 13: 9,622,653 H1032N probably damaging Het
Fbxl3 T C 14: 103,095,576 probably benign Het
Glb1 T C 9: 114,434,461 probably null Het
Gm8220 T C 14: 44,288,177 I101T probably benign Het
Gm8994 A T 6: 136,329,696 D385V probably damaging Het
Grin2b A G 6: 136,044,283 C7R possibly damaging Het
Myo15 T C 11: 60,493,583 I516T probably damaging Het
Nr1i3 A G 1: 171,215,072 D89G possibly damaging Het
Ogfod1 T G 8: 94,055,248 probably benign Het
Olfr730 G T 14: 50,186,773 S148* probably null Het
Pard3 G T 8: 127,415,743 D930Y probably damaging Het
Pde7b C T 10: 20,619,186 C9Y probably damaging Het
Pilra T A 5: 137,831,226 D192V probably damaging Het
Ptprj A G 2: 90,471,261 S176P probably benign Het
Slc4a2 T C 5: 24,435,635 V685A possibly damaging Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
Stox2 A G 8: 47,287,916 F44L possibly damaging Het
Tlr11 T C 14: 50,360,880 F108L probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A C 2: 76,808,106 I13943M probably damaging Het
Wdfy4 T C 14: 32,988,899 D2577G probably damaging Het
Other mutations in Zyg11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Zyg11a APN 4 108204902 missense probably damaging 0.99
IGL01517:Zyg11a APN 4 108201194 missense probably null 1.00
IGL01619:Zyg11a APN 4 108205217 missense probably damaging 1.00
IGL02253:Zyg11a APN 4 108183695 missense probably null 0.99
R0090:Zyg11a UTSW 4 108201347 splice site probably benign
R0225:Zyg11a UTSW 4 108204641 missense probably damaging 1.00
R0610:Zyg11a UTSW 4 108204857 missense probably damaging 1.00
R0827:Zyg11a UTSW 4 108210042 splice site probably benign
R1568:Zyg11a UTSW 4 108183646 critical splice donor site probably null
R1752:Zyg11a UTSW 4 108205282 missense possibly damaging 0.81
R2051:Zyg11a UTSW 4 108192047 splice site probably benign
R2358:Zyg11a UTSW 4 108196146 missense possibly damaging 0.94
R3898:Zyg11a UTSW 4 108210194 missense probably damaging 0.99
R4288:Zyg11a UTSW 4 108184469 missense probably damaging 1.00
R4381:Zyg11a UTSW 4 108201320 missense possibly damaging 0.58
R4709:Zyg11a UTSW 4 108205071 missense probably benign 0.00
R4859:Zyg11a UTSW 4 108210190 missense probably damaging 0.98
R5303:Zyg11a UTSW 4 108184432 critical splice donor site probably null
R5363:Zyg11a UTSW 4 108189622 missense probably damaging 1.00
R5517:Zyg11a UTSW 4 108204746 missense possibly damaging 0.94
R6175:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R6254:Zyg11a UTSW 4 108181794 missense probably damaging 1.00
R6678:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R7524:Zyg11a UTSW 4 108192074 missense probably damaging 1.00
R7789:Zyg11a UTSW 4 108183648 missense probably damaging 1.00
R8022:Zyg11a UTSW 4 108189568 critical splice donor site probably null
X0061:Zyg11a UTSW 4 108193993 missense probably damaging 1.00
Z1176:Zyg11a UTSW 4 108201282 missense probably damaging 1.00
Z1177:Zyg11a UTSW 4 108204800 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTCATTTGTTTGGTAGAACACGTTC -3'
(R):5'- CAATGTGCAGTTGTTCCTCC -3'

Sequencing Primer
(F):5'- GCACACTGAATACATACGG -3'
(R):5'- CATGGAGGCATCTTCTCAACTGAG -3'
Posted On2016-08-04