Incidental Mutation 'R5349:Grin2b'
ID 422765
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission 042928-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5349 (G1)
Quality Score 182
Status Not validated
Chromosome 6
Chromosomal Location 135713233-136173511 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 136044283 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 7 (C7R)
Ref Sequence ENSEMBL: ENSMUSP00000140452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000125905] [ENSMUST00000143943] [ENSMUST00000152012] [ENSMUST00000188999]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053880
AA Change: C7R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: C7R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111905
AA Change: C7R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: C7R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125905
AA Change: C7R

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000143943
AA Change: C7R

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000152012
AA Change: C7R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: C7R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 66 312 1.6e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188999
AA Change: C7R

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,867,958 (GRCm38) E327G possibly damaging Het
Cd209d T G 8: 3,878,320 (GRCm38) M22L probably benign Het
Chrna2 T C 14: 66,143,507 (GRCm38) V75A probably damaging Het
Cnst A G 1: 179,622,897 (GRCm38) E642G possibly damaging Het
Diaph1 A G 18: 37,891,072 (GRCm38) V571A unknown Het
Dip2c C A 13: 9,622,653 (GRCm38) H1032N probably damaging Het
Fbxl3 T C 14: 103,095,576 (GRCm38) probably benign Het
Glb1 T C 9: 114,434,461 (GRCm38) probably null Het
Gm8220 T C 14: 44,288,177 (GRCm38) I101T probably benign Het
Gm8994 A T 6: 136,329,696 (GRCm38) D385V probably damaging Het
Myo15 T C 11: 60,493,583 (GRCm38) I516T probably damaging Het
Nr1i3 A G 1: 171,215,072 (GRCm38) D89G possibly damaging Het
Ogfod1 T G 8: 94,055,248 (GRCm38) probably benign Het
Olfr730 G T 14: 50,186,773 (GRCm38) S148* probably null Het
Pard3 G T 8: 127,415,743 (GRCm38) D930Y probably damaging Het
Pde7b C T 10: 20,619,186 (GRCm38) C9Y probably damaging Het
Pilra T A 5: 137,831,226 (GRCm38) D192V probably damaging Het
Ptprj A G 2: 90,471,261 (GRCm38) S176P probably benign Het
Slc4a2 T C 5: 24,435,635 (GRCm38) V685A possibly damaging Het
Srxn1 G A 2: 152,105,879 (GRCm38) V66M probably damaging Het
Stox2 A G 8: 47,287,916 (GRCm38) F44L possibly damaging Het
Tlr11 T C 14: 50,360,880 (GRCm38) F108L probably benign Het
Ttn T A 2: 76,754,824 (GRCm38) I22042F probably damaging Het
Ttn A C 2: 76,808,106 (GRCm38) I13943M probably damaging Het
Wdfy4 T C 14: 32,988,899 (GRCm38) D2577G probably damaging Het
Zyg11a A T 4: 108,183,732 (GRCm38) F675I probably damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135,736,331 (GRCm38) missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135,733,570 (GRCm38) missense probably damaging 1.00
IGL01401:Grin2b APN 6 135,736,363 (GRCm38) missense probably damaging 1.00
IGL01523:Grin2b APN 6 136,044,265 (GRCm38) missense probably null 0.99
IGL01719:Grin2b APN 6 135,733,381 (GRCm38) missense probably damaging 0.97
IGL01907:Grin2b APN 6 135,733,740 (GRCm38) missense probably damaging 1.00
IGL01996:Grin2b APN 6 135,732,586 (GRCm38) missense probably damaging 1.00
IGL02309:Grin2b APN 6 135,736,472 (GRCm38) missense probably damaging 1.00
IGL02312:Grin2b APN 6 135,739,090 (GRCm38) missense probably damaging 1.00
IGL02409:Grin2b APN 6 136,043,908 (GRCm38) missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135,923,391 (GRCm38) missense probably damaging 1.00
IGL02535:Grin2b APN 6 135,779,369 (GRCm38) missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135,922,998 (GRCm38) missense probably damaging 1.00
IGL02702:Grin2b APN 6 135,739,132 (GRCm38) missense probably damaging 0.99
IGL03001:Grin2b APN 6 135,739,115 (GRCm38) missense probably damaging 1.00
IGL03274:Grin2b APN 6 135,780,255 (GRCm38) missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135,923,203 (GRCm38) missense probably benign
R0055:Grin2b UTSW 6 135,923,203 (GRCm38) missense probably benign
R0164:Grin2b UTSW 6 135,778,648 (GRCm38) splice site probably benign
R0194:Grin2b UTSW 6 135,779,305 (GRCm38) missense probably damaging 1.00
R0594:Grin2b UTSW 6 135,733,929 (GRCm38) missense probably damaging 1.00
R1434:Grin2b UTSW 6 135,843,195 (GRCm38) missense probably benign 0.04
R1928:Grin2b UTSW 6 136,044,046 (GRCm38) missense probably damaging 1.00
R1942:Grin2b UTSW 6 135,732,732 (GRCm38) missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136,044,211 (GRCm38) missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135,733,245 (GRCm38) missense probably damaging 1.00
R2020:Grin2b UTSW 6 135,733,896 (GRCm38) missense probably benign 0.12
R2103:Grin2b UTSW 6 135,780,140 (GRCm38) missense probably benign 0.02
R2127:Grin2b UTSW 6 135,778,700 (GRCm38) missense probably benign 0.03
R2495:Grin2b UTSW 6 135,733,182 (GRCm38) missense probably damaging 1.00
R2656:Grin2b UTSW 6 135,733,429 (GRCm38) missense probably damaging 1.00
R2847:Grin2b UTSW 6 135,740,953 (GRCm38) missense probably damaging 1.00
R2866:Grin2b UTSW 6 135,733,639 (GRCm38) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,733,639 (GRCm38) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,733,639 (GRCm38) missense probably damaging 1.00
R3196:Grin2b UTSW 6 135,732,455 (GRCm38) small deletion probably benign
R3418:Grin2b UTSW 6 135,843,110 (GRCm38) missense probably benign 0.02
R3808:Grin2b UTSW 6 135,923,271 (GRCm38) missense probably damaging 0.99
R4028:Grin2b UTSW 6 135,736,435 (GRCm38) missense probably damaging 1.00
R4602:Grin2b UTSW 6 135,778,741 (GRCm38) missense probably damaging 1.00
R4624:Grin2b UTSW 6 135,733,825 (GRCm38) missense probably damaging 0.99
R4677:Grin2b UTSW 6 135,774,872 (GRCm38) missense probably benign 0.13
R4744:Grin2b UTSW 6 135,778,699 (GRCm38) missense probably damaging 1.00
R5020:Grin2b UTSW 6 135,733,407 (GRCm38) missense probably benign 0.01
R5051:Grin2b UTSW 6 135,779,395 (GRCm38) missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135,732,441 (GRCm38) missense probably benign 0.03
R5125:Grin2b UTSW 6 135,923,299 (GRCm38) missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135,779,342 (GRCm38) missense probably damaging 1.00
R5318:Grin2b UTSW 6 135,733,918 (GRCm38) missense probably damaging 0.99
R5426:Grin2b UTSW 6 135,732,368 (GRCm38) missense probably damaging 1.00
R5438:Grin2b UTSW 6 135,736,306 (GRCm38) missense probably damaging 1.00
R5439:Grin2b UTSW 6 135,736,306 (GRCm38) missense probably damaging 1.00
R5440:Grin2b UTSW 6 135,736,306 (GRCm38) missense probably damaging 1.00
R5530:Grin2b UTSW 6 135,733,723 (GRCm38) missense probably benign 0.00
R5603:Grin2b UTSW 6 135,923,397 (GRCm38) missense probably damaging 1.00
R5657:Grin2b UTSW 6 135,733,087 (GRCm38) missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135,740,964 (GRCm38) missense probably benign 0.24
R5941:Grin2b UTSW 6 135,736,373 (GRCm38) missense probably damaging 0.99
R6057:Grin2b UTSW 6 135,733,944 (GRCm38) missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135,923,458 (GRCm38) missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135,772,399 (GRCm38) missense probably damaging 1.00
R6309:Grin2b UTSW 6 135,733,027 (GRCm38) missense probably benign 0.00
R6316:Grin2b UTSW 6 135,780,279 (GRCm38) missense probably benign 0.00
R6419:Grin2b UTSW 6 135,740,967 (GRCm38) missense probably damaging 1.00
R6551:Grin2b UTSW 6 135,733,344 (GRCm38) missense probably damaging 1.00
R6612:Grin2b UTSW 6 135,740,998 (GRCm38) missense probably damaging 1.00
R6616:Grin2b UTSW 6 135,732,551 (GRCm38) missense probably benign
R6647:Grin2b UTSW 6 135,733,110 (GRCm38) missense probably damaging 1.00
R6806:Grin2b UTSW 6 135,774,828 (GRCm38) missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135,780,200 (GRCm38) missense probably benign
R7033:Grin2b UTSW 6 135,923,038 (GRCm38) missense probably damaging 1.00
R7058:Grin2b UTSW 6 135,780,306 (GRCm38) missense probably damaging 0.97
R7144:Grin2b UTSW 6 135,733,476 (GRCm38) missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135,732,948 (GRCm38) missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135,780,251 (GRCm38) missense probably damaging 0.97
R7453:Grin2b UTSW 6 135,740,949 (GRCm38) missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135,772,396 (GRCm38) missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135,779,303 (GRCm38) missense probably damaging 0.99
R7615:Grin2b UTSW 6 135,923,364 (GRCm38) missense probably damaging 1.00
R7632:Grin2b UTSW 6 135,732,555 (GRCm38) missense probably benign 0.02
R7779:Grin2b UTSW 6 135,778,794 (GRCm38) nonsense probably null
R8058:Grin2b UTSW 6 135,733,227 (GRCm38) missense probably damaging 1.00
R8084:Grin2b UTSW 6 135,733,488 (GRCm38) missense probably benign 0.03
R8145:Grin2b UTSW 6 135,732,499 (GRCm38) missense probably benign 0.01
R8308:Grin2b UTSW 6 135,923,076 (GRCm38) missense probably damaging 0.99
R8357:Grin2b UTSW 6 135,732,199 (GRCm38) missense probably benign 0.00
R8379:Grin2b UTSW 6 135,922,969 (GRCm38) missense probably damaging 1.00
R8429:Grin2b UTSW 6 135,733,916 (GRCm38) missense probably damaging 1.00
R8457:Grin2b UTSW 6 135,732,199 (GRCm38) missense probably benign 0.00
R8746:Grin2b UTSW 6 135,922,987 (GRCm38) missense probably benign 0.02
R8925:Grin2b UTSW 6 135,772,341 (GRCm38) missense probably damaging 0.97
R8927:Grin2b UTSW 6 135,772,341 (GRCm38) missense probably damaging 0.97
R8963:Grin2b UTSW 6 136,044,009 (GRCm38) missense probably damaging 1.00
R9075:Grin2b UTSW 6 135,732,511 (GRCm38) frame shift probably null
R9076:Grin2b UTSW 6 135,732,511 (GRCm38) frame shift probably null
R9172:Grin2b UTSW 6 135,779,257 (GRCm38) missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135,733,401 (GRCm38) missense probably damaging 1.00
R9740:Grin2b UTSW 6 135,922,870 (GRCm38) critical splice donor site probably null
RF001:Grin2b UTSW 6 136,044,240 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCATGGCTACCAGCTCCAC -3'
(R):5'- CCCATGAACGTCAGAATTAAGAGAC -3'

Sequencing Primer
(F):5'- ACCCGGGGAACTACTGAG -3'
(R):5'- CGTCAGAATTAAGAGACTGGGTTAGC -3'
Posted On 2016-08-04