Incidental Mutation 'R5349:Grin2b'

• ID: 422765
• Institutional Source: Beutler Lab
• Gene Symbol: Grin2b
• Ensembl Gene: ENSMUSG00000030209
• Gene Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
• Synonyms: GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
• MMRRC Submission: 042928-MU
• Essential gene?: Essential (E-score: 1.000)
• Stock #: R5349 (G1)
• Quality Score: 182
• Status: Not validated
• Chromosome: 6
• Chromosomal Location: 135713233-136173511 bp(-) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): A to G at 136044283 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Cysteine to Arginine at position 7 (C7R)
• Ref Sequence: ENSEMBL: ENSMUSP00000140452
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000125905] [ENSMUST00000143943] [ENSMUST00000152012] [ENSMUST00000188999]
• AlphaFold: no structure available at present
• Predicted Effect: probably benign; Transcript: ENSMUST00000053880; AA Change: C7R; PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
• SMART Domains: Protein: ENSMUSP00000062284; Gene: ENSMUSG00000030209; AA Change: C7R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

• Predicted Effect: probably benign; Transcript: ENSMUST00000111905; AA Change: C7R; PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
• SMART Domains: Protein: ENSMUSP00000107536; Gene: ENSMUSG00000030209; AA Change: C7R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

• Predicted Effect: possibly damaging; Transcript: ENSMUST00000125905; AA Change: C7R; PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
• Predicted Effect: possibly damaging; Transcript: ENSMUST00000143943; AA Change: C7R; PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
• Predicted Effect: probably benign; Transcript: ENSMUST00000152012; AA Change: C7R; PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
• SMART Domains: Protein: ENSMUSP00000142696; Gene: ENSMUSG00000030209; AA Change: C7R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	66	312	1.6e-9	PFAM

• Predicted Effect: possibly damaging; Transcript: ENSMUST00000188999; AA Change: C7R; PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
• Coding Region Coverage:
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
• Posted On: 2016-08-04

Predicted Primers

PCR Primer
(F):5'- TTCATGGCTACCAGCTCCAC -3'
(R):5'- CCCATGAACGTCAGAATTAAGAGAC -3'

Sequencing Primer
(F):5'- ACCCGGGGAACTACTGAG -3'
(R):5'- CGTCAGAATTAAGAGACTGGGTTAGC -3'