Incidental Mutation 'R5349:Olfr730'
ID422778
Institutional Source Beutler Lab
Gene Symbol Olfr730
Ensembl Gene ENSMUSG00000109835
Gene Nameolfactory receptor 730
SynonymsGA_x6K02T2PMLR-5881670-5880717, MOR247-1
MMRRC Submission 042928-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R5349 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50183296-50188198 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 50186773 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 148 (S148*)
Ref Sequence ENSEMBL: ENSMUSP00000145742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051453] [ENSMUST00000205837]
Predicted Effect probably null
Transcript: ENSMUST00000051453
AA Change: S149*
SMART Domains Protein: ENSMUSP00000060325
Gene: ENSMUSG00000109835
AA Change: S149*

DomainStartEndE-ValueType
Pfam:7tm_4 32 305 3.4e-44 PFAM
Pfam:7tm_1 42 288 1.2e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205837
AA Change: S148*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215779
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,867,958 E327G possibly damaging Het
Cd209d T G 8: 3,878,320 M22L probably benign Het
Chrna2 T C 14: 66,143,507 V75A probably damaging Het
Cnst A G 1: 179,622,897 E642G possibly damaging Het
Diaph1 A G 18: 37,891,072 V571A unknown Het
Dip2c C A 13: 9,622,653 H1032N probably damaging Het
Fbxl3 T C 14: 103,095,576 probably benign Het
Glb1 T C 9: 114,434,461 probably null Het
Gm8220 T C 14: 44,288,177 I101T probably benign Het
Gm8994 A T 6: 136,329,696 D385V probably damaging Het
Grin2b A G 6: 136,044,283 C7R possibly damaging Het
Myo15 T C 11: 60,493,583 I516T probably damaging Het
Nr1i3 A G 1: 171,215,072 D89G possibly damaging Het
Ogfod1 T G 8: 94,055,248 probably benign Het
Pard3 G T 8: 127,415,743 D930Y probably damaging Het
Pde7b C T 10: 20,619,186 C9Y probably damaging Het
Pilra T A 5: 137,831,226 D192V probably damaging Het
Ptprj A G 2: 90,471,261 S176P probably benign Het
Slc4a2 T C 5: 24,435,635 V685A possibly damaging Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
Stox2 A G 8: 47,287,916 F44L possibly damaging Het
Tlr11 T C 14: 50,360,880 F108L probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A C 2: 76,808,106 I13943M probably damaging Het
Wdfy4 T C 14: 32,988,899 D2577G probably damaging Het
Zyg11a A T 4: 108,183,732 F675I probably damaging Het
Other mutations in Olfr730
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01998:Olfr730 APN 14 50186648 missense probably benign 0.36
IGL02976:Olfr730 APN 14 50186432 nonsense probably null
IGL03065:Olfr730 APN 14 50187008 missense probably damaging 1.00
IGL03122:Olfr730 APN 14 50187004 missense probably damaging 0.98
R0277:Olfr730 UTSW 14 50186332 missense probably null 0.06
R1081:Olfr730 UTSW 14 50187197 missense probably damaging 1.00
R1189:Olfr730 UTSW 14 50187082 missense probably damaging 0.99
R1501:Olfr730 UTSW 14 50187082 missense probably damaging 0.99
R2680:Olfr730 UTSW 14 50186847 nonsense probably null
R2869:Olfr730 UTSW 14 50186354 missense probably benign 0.08
R2869:Olfr730 UTSW 14 50186354 missense probably benign 0.08
R3415:Olfr730 UTSW 14 50186612 missense possibly damaging 0.60
R3417:Olfr730 UTSW 14 50186612 missense possibly damaging 0.60
R3721:Olfr730 UTSW 14 50186680 missense probably damaging 1.00
R4864:Olfr730 UTSW 14 50186582 missense probably damaging 0.97
R5037:Olfr730 UTSW 14 50186288 missense probably benign 0.00
R5738:Olfr730 UTSW 14 50186648 missense probably benign 0.09
R5779:Olfr730 UTSW 14 50186746 missense possibly damaging 0.82
R5853:Olfr730 UTSW 14 50186869 missense possibly damaging 0.88
R5918:Olfr730 UTSW 14 50186968 missense probably benign
R6166:Olfr730 UTSW 14 50186768 missense probably benign
R6196:Olfr730 UTSW 14 50186678 missense probably damaging 1.00
R6218:Olfr730 UTSW 14 50186678 missense probably damaging 1.00
R6220:Olfr730 UTSW 14 50186678 missense probably damaging 1.00
R6561:Olfr730 UTSW 14 50186318 missense probably damaging 1.00
R6798:Olfr730 UTSW 14 50187127 missense probably benign 0.00
R6834:Olfr730 UTSW 14 50186483 missense probably benign 0.12
R7174:Olfr730 UTSW 14 50186696 missense probably benign 0.00
R7406:Olfr730 UTSW 14 50186558 missense probably damaging 0.97
R7592:Olfr730 UTSW 14 50186563 missense probably damaging 1.00
R7886:Olfr730 UTSW 14 50186564 missense probably damaging 1.00
R7969:Olfr730 UTSW 14 50186564 missense probably damaging 1.00
X0023:Olfr730 UTSW 14 50187201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCTTGATAGTAACCAGCAC -3'
(R):5'- CAATCTCTTTTGATGGATGCATTGC -3'

Sequencing Primer
(F):5'- GCTTGATAGTAACCAGCACAATAATG -3'
(R):5'- GATGGATGCATTGCTCAGATATTC -3'
Posted On2016-08-04