Incidental Mutation 'R5349:Tlr11'
ID422779
Institutional Source Beutler Lab
Gene Symbol Tlr11
Ensembl Gene ENSMUSG00000051969
Gene Nametoll-like receptor 11
SynonymsLOC239081
MMRRC Submission 042928-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5349 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50357914-50363663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50360880 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 108 (F108L)
Ref Sequence ENSEMBL: ENSMUSP00000138814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063570] [ENSMUST00000185091]
Predicted Effect probably benign
Transcript: ENSMUST00000063570
AA Change: F103L

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068906
Gene: ENSMUSG00000051969
AA Change: F103L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 153 161 N/A INTRINSIC
LRR 311 333 3.36e1 SMART
LRR 335 361 4.44e0 SMART
LRR 362 383 2.03e1 SMART
LRR_TYP 384 407 2.57e-3 SMART
LRR_TYP 408 431 2.75e-3 SMART
low complexity region 544 556 N/A INTRINSIC
LRR 605 628 6.06e1 SMART
transmembrane domain 719 741 N/A INTRINSIC
Pfam:TIR 773 922 2.1e-9 PFAM
Pfam:TIR_2 776 894 6.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185091
AA Change: F108L

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138814
Gene: ENSMUSG00000051969
AA Change: F108L

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 158 166 N/A INTRINSIC
Pfam:LRR_6 221 244 5.3e-2 PFAM
LRR 316 338 3.36e1 SMART
LRR 340 366 4.44e0 SMART
LRR 367 388 2.03e1 SMART
LRR_TYP 389 412 2.57e-3 SMART
LRR_TYP 413 436 2.75e-3 SMART
low complexity region 549 561 N/A INTRINSIC
LRR 610 633 6.06e1 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:TIR_2 781 898 1e-12 PFAM
Pfam:TIR 781 922 1.8e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 T C 19: 4,867,958 E327G possibly damaging Het
Cd209d T G 8: 3,878,320 M22L probably benign Het
Chrna2 T C 14: 66,143,507 V75A probably damaging Het
Cnst A G 1: 179,622,897 E642G possibly damaging Het
Diaph1 A G 18: 37,891,072 V571A unknown Het
Dip2c C A 13: 9,622,653 H1032N probably damaging Het
Fbxl3 T C 14: 103,095,576 probably benign Het
Glb1 T C 9: 114,434,461 probably null Het
Gm8220 T C 14: 44,288,177 I101T probably benign Het
Gm8994 A T 6: 136,329,696 D385V probably damaging Het
Grin2b A G 6: 136,044,283 C7R possibly damaging Het
Myo15 T C 11: 60,493,583 I516T probably damaging Het
Nr1i3 A G 1: 171,215,072 D89G possibly damaging Het
Ogfod1 T G 8: 94,055,248 probably benign Het
Olfr730 G T 14: 50,186,773 S148* probably null Het
Pard3 G T 8: 127,415,743 D930Y probably damaging Het
Pde7b C T 10: 20,619,186 C9Y probably damaging Het
Pilra T A 5: 137,831,226 D192V probably damaging Het
Ptprj A G 2: 90,471,261 S176P probably benign Het
Slc4a2 T C 5: 24,435,635 V685A possibly damaging Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
Stox2 A G 8: 47,287,916 F44L possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A C 2: 76,808,106 I13943M probably damaging Het
Wdfy4 T C 14: 32,988,899 D2577G probably damaging Het
Zyg11a A T 4: 108,183,732 F675I probably damaging Het
Other mutations in Tlr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tlr11 APN 14 50360916 missense probably benign
IGL02090:Tlr11 APN 14 50363032 missense probably damaging 0.99
IGL02286:Tlr11 APN 14 50360871 missense possibly damaging 0.91
IGL02671:Tlr11 APN 14 50360692 missense probably damaging 1.00
IGL03064:Tlr11 APN 14 50361100 missense probably damaging 1.00
IGL03068:Tlr11 APN 14 50361484 missense probably benign
R0099:Tlr11 UTSW 14 50360818 missense probably benign 0.14
R0727:Tlr11 UTSW 14 50361469 missense possibly damaging 0.67
R0944:Tlr11 UTSW 14 50362336 missense probably benign 0.12
R1490:Tlr11 UTSW 14 50363176 missense probably benign 0.00
R1726:Tlr11 UTSW 14 50361541 missense probably benign 0.00
R1803:Tlr11 UTSW 14 50360647 missense probably benign 0.00
R1908:Tlr11 UTSW 14 50361207 missense probably benign 0.00
R1971:Tlr11 UTSW 14 50361234 missense probably benign
R1981:Tlr11 UTSW 14 50361988 missense possibly damaging 0.95
R2023:Tlr11 UTSW 14 50362569 missense probably damaging 0.96
R2079:Tlr11 UTSW 14 50360980 missense probably damaging 0.99
R2155:Tlr11 UTSW 14 50360682 missense probably benign 0.01
R2251:Tlr11 UTSW 14 50360792 missense probably benign 0.02
R3017:Tlr11 UTSW 14 50362721 nonsense probably null
R3760:Tlr11 UTSW 14 50362243 missense probably damaging 1.00
R3876:Tlr11 UTSW 14 50363154 missense probably benign
R3936:Tlr11 UTSW 14 50362735 missense possibly damaging 0.78
R4002:Tlr11 UTSW 14 50362527 missense probably benign
R4024:Tlr11 UTSW 14 50362846 missense probably benign 0.02
R4118:Tlr11 UTSW 14 50363227 missense probably damaging 1.00
R4222:Tlr11 UTSW 14 50361849 missense probably damaging 0.99
R4365:Tlr11 UTSW 14 50361469 missense probably damaging 0.98
R4678:Tlr11 UTSW 14 50360982 missense possibly damaging 0.85
R4779:Tlr11 UTSW 14 50361250 missense possibly damaging 0.76
R4910:Tlr11 UTSW 14 50362889 missense probably benign 0.45
R4921:Tlr11 UTSW 14 50362885 missense possibly damaging 0.48
R5114:Tlr11 UTSW 14 50363121 missense possibly damaging 0.81
R5126:Tlr11 UTSW 14 50360830 missense probably damaging 1.00
R5606:Tlr11 UTSW 14 50362260 missense probably benign 0.08
R5650:Tlr11 UTSW 14 50361201 missense probably benign 0.03
R5958:Tlr11 UTSW 14 50360777 missense probably damaging 0.99
R5966:Tlr11 UTSW 14 50362255 missense probably benign 0.02
R6480:Tlr11 UTSW 14 50363055 missense possibly damaging 0.62
R6484:Tlr11 UTSW 14 50362678 missense probably damaging 0.99
R6679:Tlr11 UTSW 14 50362854 missense probably benign 0.00
R6717:Tlr11 UTSW 14 50362104 missense probably benign
R7085:Tlr11 UTSW 14 50362656 missense probably damaging 0.99
R7241:Tlr11 UTSW 14 50362141 missense possibly damaging 0.95
R7440:Tlr11 UTSW 14 50361344 missense probably benign 0.00
R7482:Tlr11 UTSW 14 50362999 missense probably damaging 0.99
R7582:Tlr11 UTSW 14 50361729 nonsense probably null
Z1088:Tlr11 UTSW 14 50362338 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGCCTTACCTTGACTGGCTG -3'
(R):5'- GACTACTAAGGGATCTAAGAGACTC -3'

Sequencing Primer
(F):5'- ATGGACCATCCCTGATTGCATCATAG -3'
(R):5'- ACTAAGGGATCTAAGAGACTCAAAAC -3'
Posted On2016-08-04