Incidental Mutation 'R5361:Ltbr'
ID422806
Institutional Source Beutler Lab
Gene Symbol Ltbr
Ensembl Gene ENSMUSG00000030339
Gene Namelymphotoxin B receptor
SynonymsTNF-R-III, TNFRrp, TNFCR, TNFR2-RP, LTbetaR, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Tnfrsf3, Ltar
MMRRC Submission 042940-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R5361 (G1)
Quality Score220
Status Not validated
Chromosome6
Chromosomal Location125306571-125313885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125312794 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 146 (R146W)
Ref Sequence ENSEMBL: ENSMUSP00000032489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032489]
Predicted Effect probably damaging
Transcript: ENSMUST00000032489
AA Change: R146W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032489
Gene: ENSMUSG00000030339
AA Change: R146W

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
TNFR 43 80 5.73e-5 SMART
TNFR 83 124 3.96e-8 SMART
Blast:TNFR 126 169 3e-7 BLAST
TNFR 172 212 1.95e-7 SMART
transmembrane domain 222 244 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 362 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161891
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a targeted null mutation lack Peyer's patches, colon-associated lymphoid tissues, and lymph nodes. Mutants also exhibit severely reduced numbers of NK cells and increased susceptibility to Theiler's murine encephalomyelitis virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T A 9: 57,257,185 K635N probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahnak T A 19: 9,015,341 M4663K possibly damaging Het
C4b T A 17: 34,741,238 T280S probably benign Het
Ccdc166 A G 15: 75,981,020 V366A probably benign Het
Cdh23 A G 10: 60,657,265 probably null Het
Col7a1 A G 9: 108,963,224 T1281A unknown Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Dbndd1 T A 8: 123,506,745 D127V probably damaging Het
Ddx20 T A 3: 105,683,509 E197V probably damaging Het
Dnm3 A G 1: 162,010,902 S826P probably damaging Het
Dnmt3a T C 12: 3,895,643 V24A probably benign Het
Dopey2 C A 16: 93,770,504 A1273E probably damaging Het
Dsg1c T C 18: 20,283,646 V868A possibly damaging Het
Dtx4 A G 19: 12,485,262 probably null Het
Elovl4 A G 9: 83,790,101 L55P possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam45a A G 19: 60,825,886 M96V probably benign Het
Fbxo40 T A 16: 36,969,552 T399S possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm14399 T C 2: 175,131,578 E96G probably damaging Het
Gm14496 T G 2: 182,000,354 V606G probably benign Het
Gpr156 A G 16: 38,005,725 E768G probably damaging Het
Grm5 A T 7: 88,074,496 T665S probably damaging Het
Hsdl2 A G 4: 59,592,301 probably benign Het
Htt T C 5: 34,907,584 V3047A possibly damaging Het
Igkv3-2 A T 6: 70,699,027 T107S probably benign Het
Itih2 T A 2: 10,096,461 T899S probably benign Het
Lhcgr T A 17: 88,742,853 Y415F probably damaging Het
Med4 C A 14: 73,510,113 S18* probably null Het
Nefl T C 14: 68,084,639 V226A probably damaging Het
Nploc4 T A 11: 120,384,563 N516Y probably damaging Het
Olfr798 A T 10: 129,625,732 F110I probably damaging Het
Olfr99 A G 17: 37,279,610 V270A probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdha3 T G 18: 36,946,699 L165V possibly damaging Het
Pcdhb12 T A 18: 37,437,046 V415D probably damaging Het
Pcdhga10 T C 18: 37,747,450 I88T probably damaging Het
Pigyl T A 9: 22,157,996 M1K probably null Het
Prr27 T C 5: 87,843,344 S272P probably damaging Het
Prss3 C T 6: 41,373,846 D237N probably benign Het
Pstpip2 A G 18: 77,870,378 D150G probably damaging Het
Robo4 T A 9: 37,413,378 D909E probably benign Het
Serpinb3c A T 1: 107,276,931 Y28* probably null Het
Slc26a3 T C 12: 31,450,981 probably null Het
Slc6a1 A T 6: 114,302,532 I91F probably benign Het
Smcr8 T G 11: 60,778,292 Y89D probably damaging Het
Sspo T A 6: 48,466,313 M1898K probably benign Het
Tbl1xr1 T A 3: 22,192,069 I251K probably damaging Het
Thbs4 C T 13: 92,776,993 D140N probably benign Het
Tmbim6 G A 15: 99,405,752 A108T probably benign Het
Trim10 T G 17: 36,875,436 L301R probably benign Het
Trpm7 A T 2: 126,829,241 I607N possibly damaging Het
Vmn2r9 T A 5: 108,848,063 I240F probably damaging Het
Xpot T A 10: 121,600,860 I873F possibly damaging Het
Zfhx4 G A 3: 5,399,207 S1475N probably damaging Het
Zfp712 A G 13: 67,041,015 S483P possibly damaging Het
Zswim7 A T 11: 62,267,547 H122Q probably benign Het
Other mutations in Ltbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03349:Ltbr APN 6 125312366 missense probably damaging 0.96
armitage UTSW 6 125312794 missense probably damaging 0.97
bonsai UTSW 6 125312770 missense probably damaging 1.00
kama UTSW 6 125313388 critical splice donor site probably null
marine_blue UTSW 6 125312808 missense probably damaging 0.98
moksha UTSW 6 125308068 missense probably benign 0.00
Questionable UTSW 6 125313375 splice site probably benign
R0090:Ltbr UTSW 6 125309449 splice site probably benign
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0553:Ltbr UTSW 6 125313388 critical splice donor site probably null
R0686:Ltbr UTSW 6 125308061 missense possibly damaging 0.88
R0879:Ltbr UTSW 6 125313375 splice site probably benign
R1086:Ltbr UTSW 6 125312740 splice site probably benign
R2118:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2120:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2122:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2124:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2199:Ltbr UTSW 6 125312061 missense probably benign 0.25
R4931:Ltbr UTSW 6 125307474 splice site probably null
R5051:Ltbr UTSW 6 125312770 missense probably damaging 1.00
R5174:Ltbr UTSW 6 125309537 missense probably benign 0.00
R5268:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5269:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5357:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5358:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5360:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5363:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5434:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5436:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5441:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5442:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5533:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5534:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5859:Ltbr UTSW 6 125312808 missense probably damaging 0.98
R6217:Ltbr UTSW 6 125307454 missense probably damaging 1.00
R6702:Ltbr UTSW 6 125308068 missense probably benign 0.00
R7101:Ltbr UTSW 6 125312800 missense probably benign 0.00
R7584:Ltbr UTSW 6 125307241 missense probably benign 0.09
R7587:Ltbr UTSW 6 125312352 missense probably benign
R8798:Ltbr UTSW 6 125307295 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATACCAGTTCATGTCTTGGCAG -3'
(R):5'- CTGCATGATGGGTACGACTG -3'

Sequencing Primer
(F):5'- GACTGATAGATTCTTTATGGTTCTCC -3'
(R):5'- TACGACTGGGAGGGCCAG -3'
Posted On2016-08-04