Incidental Mutation 'R5361:Nploc4'
ID422821
Institutional Source Beutler Lab
Gene Symbol Nploc4
Ensembl Gene ENSMUSG00000039703
Gene NameNPL4 homolog, ubiquitin recognition factor
Synonyms
MMRRC Submission 042940-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5361 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120380370-120437708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120384563 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 516 (N516Y)
Ref Sequence ENSEMBL: ENSMUSP00000035851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044271] [ENSMUST00000103017]
PDB Structure
Strctural Model of the p97 N domain- npl4 UBD complex [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000044271
AA Change: N516Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035851
Gene: ENSMUSG00000039703
AA Change: N516Y

DomainStartEndE-ValueType
Pfam:UN_NPL4 1 80 1.1e-36 PFAM
Pfam:zf-NPL4 105 245 2.1e-64 PFAM
Pfam:NPL4 248 557 4.8e-129 PFAM
ZnF_RBZ 582 606 8.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103017
AA Change: N484Y

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099306
Gene: ENSMUSG00000039703
AA Change: N484Y

DomainStartEndE-ValueType
Pfam:UN_NPL4 1 80 7e-38 PFAM
Pfam:zf-NPL4 104 246 1.1e-61 PFAM
Pfam:NPL4 248 455 1.8e-87 PFAM
Pfam:NPL4 451 525 3e-15 PFAM
ZnF_RBZ 550 574 8.4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137041
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T A 9: 57,257,185 K635N probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahnak T A 19: 9,015,341 M4663K possibly damaging Het
C4b T A 17: 34,741,238 T280S probably benign Het
Ccdc166 A G 15: 75,981,020 V366A probably benign Het
Cdh23 A G 10: 60,657,265 probably null Het
Col7a1 A G 9: 108,963,224 T1281A unknown Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Dbndd1 T A 8: 123,506,745 D127V probably damaging Het
Ddx20 T A 3: 105,683,509 E197V probably damaging Het
Dnm3 A G 1: 162,010,902 S826P probably damaging Het
Dnmt3a T C 12: 3,895,643 V24A probably benign Het
Dopey2 C A 16: 93,770,504 A1273E probably damaging Het
Dsg1c T C 18: 20,283,646 V868A possibly damaging Het
Dtx4 A G 19: 12,485,262 probably null Het
Elovl4 A G 9: 83,790,101 L55P possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam45a A G 19: 60,825,886 M96V probably benign Het
Fbxo40 T A 16: 36,969,552 T399S possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm14399 T C 2: 175,131,578 E96G probably damaging Het
Gm14496 T G 2: 182,000,354 V606G probably benign Het
Gpr156 A G 16: 38,005,725 E768G probably damaging Het
Grm5 A T 7: 88,074,496 T665S probably damaging Het
Hsdl2 A G 4: 59,592,301 probably benign Het
Htt T C 5: 34,907,584 V3047A possibly damaging Het
Igkv3-2 A T 6: 70,699,027 T107S probably benign Het
Itih2 T A 2: 10,096,461 T899S probably benign Het
Lhcgr T A 17: 88,742,853 Y415F probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Med4 C A 14: 73,510,113 S18* probably null Het
Nefl T C 14: 68,084,639 V226A probably damaging Het
Olfr798 A T 10: 129,625,732 F110I probably damaging Het
Olfr99 A G 17: 37,279,610 V270A probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdha3 T G 18: 36,946,699 L165V possibly damaging Het
Pcdhb12 T A 18: 37,437,046 V415D probably damaging Het
Pcdhga10 T C 18: 37,747,450 I88T probably damaging Het
Pigyl T A 9: 22,157,996 M1K probably null Het
Prr27 T C 5: 87,843,344 S272P probably damaging Het
Prss3 C T 6: 41,373,846 D237N probably benign Het
Pstpip2 A G 18: 77,870,378 D150G probably damaging Het
Robo4 T A 9: 37,413,378 D909E probably benign Het
Serpinb3c A T 1: 107,276,931 Y28* probably null Het
Slc26a3 T C 12: 31,450,981 probably null Het
Slc6a1 A T 6: 114,302,532 I91F probably benign Het
Smcr8 T G 11: 60,778,292 Y89D probably damaging Het
Sspo T A 6: 48,466,313 M1898K probably benign Het
Tbl1xr1 T A 3: 22,192,069 I251K probably damaging Het
Thbs4 C T 13: 92,776,993 D140N probably benign Het
Tmbim6 G A 15: 99,405,752 A108T probably benign Het
Trim10 T G 17: 36,875,436 L301R probably benign Het
Trpm7 A T 2: 126,829,241 I607N possibly damaging Het
Vmn2r9 T A 5: 108,848,063 I240F probably damaging Het
Xpot T A 10: 121,600,860 I873F possibly damaging Het
Zfhx4 G A 3: 5,399,207 S1475N probably damaging Het
Zfp712 A G 13: 67,041,015 S483P possibly damaging Het
Zswim7 A T 11: 62,267,547 H122Q probably benign Het
Other mutations in Nploc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Nploc4 APN 11 120389372 missense probably benign 0.06
IGL03373:Nploc4 APN 11 120409629 nonsense probably null
P0041:Nploc4 UTSW 11 120418331 missense probably damaging 1.00
R0200:Nploc4 UTSW 11 120413681 missense probably damaging 1.00
R0608:Nploc4 UTSW 11 120413681 missense probably damaging 1.00
R1401:Nploc4 UTSW 11 120383289 splice site probably benign
R1465:Nploc4 UTSW 11 120408781 missense probably damaging 0.98
R1465:Nploc4 UTSW 11 120408781 missense probably damaging 0.98
R1722:Nploc4 UTSW 11 120382569 missense probably benign 0.02
R1919:Nploc4 UTSW 11 120404229 missense probably damaging 1.00
R2436:Nploc4 UTSW 11 120418317 missense possibly damaging 0.79
R4603:Nploc4 UTSW 11 120385787 missense probably benign 0.00
R4771:Nploc4 UTSW 11 120421434 missense possibly damaging 0.47
R5179:Nploc4 UTSW 11 120408856 missense probably benign 0.02
R5414:Nploc4 UTSW 11 120413643 missense probably damaging 0.99
R5567:Nploc4 UTSW 11 120384614 missense probably benign 0.00
R5570:Nploc4 UTSW 11 120384614 missense probably benign 0.00
R6259:Nploc4 UTSW 11 120385865 missense probably benign 0.01
R6547:Nploc4 UTSW 11 120428522 critical splice donor site probably null
R6683:Nploc4 UTSW 11 120383330 missense probably damaging 0.98
R7134:Nploc4 UTSW 11 120385788 missense probably benign 0.02
R7256:Nploc4 UTSW 11 120428550 missense probably benign
R7284:Nploc4 UTSW 11 120416370 missense possibly damaging 0.89
R7386:Nploc4 UTSW 11 120408881 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCTCTGAGGCTATGCAACAG -3'
(R):5'- CTGAGACAGGATCGTGCATCTG -3'

Sequencing Primer
(F):5'- GCTATGCAACAGGGACAGTCTC -3'
(R):5'- TTGGTTAGTAAGAGGCAGCACTC -3'
Posted On2016-08-04