Mutagenetix > Incidental Mutation

Incidental Mutation 'R5361:Thbs4'

422824

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

042940-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5361 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 92776993 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 140 (D140N)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably benign
Transcript: ENSMUST00000022213
AA Change: D140N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: D140N

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168299

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	T	A	9: 57,257,185	K635N	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ahnak	T	A	19: 9,015,341	M4663K	possibly damaging	Het
C4b	T	A	17: 34,741,238	T280S	probably benign	Het
Ccdc166	A	G	15: 75,981,020	V366A	probably benign	Het
Cdh23	A	G	10: 60,657,265		probably null	Het
Col7a1	A	G	9: 108,963,224	T1281A	unknown	Het
Cul9	TTCCTCCTCCTCCTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCCTC	17: 46,500,849		probably benign	Het
Dbndd1	T	A	8: 123,506,745	D127V	probably damaging	Het
Ddx20	T	A	3: 105,683,509	E197V	probably damaging	Het
Dnm3	A	G	1: 162,010,902	S826P	probably damaging	Het
Dnmt3a	T	C	12: 3,895,643	V24A	probably benign	Het
Dopey2	C	A	16: 93,770,504	A1273E	probably damaging	Het
Dsg1c	T	C	18: 20,283,646	V868A	possibly damaging	Het
Dtx4	A	G	19: 12,485,262		probably null	Het
Elovl4	A	G	9: 83,790,101	L55P	possibly damaging	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fam45a	A	G	19: 60,825,886	M96V	probably benign	Het
Fbxo40	T	A	16: 36,969,552	T399S	possibly damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gm14399	T	C	2: 175,131,578	E96G	probably damaging	Het
Gm14496	T	G	2: 182,000,354	V606G	probably benign	Het
Gpr156	A	G	16: 38,005,725	E768G	probably damaging	Het
Grm5	A	T	7: 88,074,496	T665S	probably damaging	Het
Hsdl2	A	G	4: 59,592,301		probably benign	Het
Htt	T	C	5: 34,907,584	V3047A	possibly damaging	Het
Igkv3-2	A	T	6: 70,699,027	T107S	probably benign	Het
Itih2	T	A	2: 10,096,461	T899S	probably benign	Het
Lhcgr	T	A	17: 88,742,853	Y415F	probably damaging	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Med4	C	A	14: 73,510,113	S18*	probably null	Het
Nefl	T	C	14: 68,084,639	V226A	probably damaging	Het
Nploc4	T	A	11: 120,384,563	N516Y	probably damaging	Het
Olfr798	A	T	10: 129,625,732	F110I	probably damaging	Het
Olfr99	A	G	17: 37,279,610	V270A	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdha3	T	G	18: 36,946,699	L165V	possibly damaging	Het
Pcdhb12	T	A	18: 37,437,046	V415D	probably damaging	Het
Pcdhga10	T	C	18: 37,747,450	I88T	probably damaging	Het
Pigyl	T	A	9: 22,157,996	M1K	probably null	Het
Prr27	T	C	5: 87,843,344	S272P	probably damaging	Het
Prss3	C	T	6: 41,373,846	D237N	probably benign	Het
Pstpip2	A	G	18: 77,870,378	D150G	probably damaging	Het
Robo4	T	A	9: 37,413,378	D909E	probably benign	Het
Serpinb3c	A	T	1: 107,276,931	Y28*	probably null	Het
Slc26a3	T	C	12: 31,450,981		probably null	Het
Slc6a1	A	T	6: 114,302,532	I91F	probably benign	Het
Smcr8	T	G	11: 60,778,292	Y89D	probably damaging	Het
Sspo	T	A	6: 48,466,313	M1898K	probably benign	Het
Tbl1xr1	T	A	3: 22,192,069	I251K	probably damaging	Het
Tmbim6	G	A	15: 99,405,752	A108T	probably benign	Het
Trim10	T	G	17: 36,875,436	L301R	probably benign	Het
Trpm7	A	T	2: 126,829,241	I607N	possibly damaging	Het
Vmn2r9	T	A	5: 108,848,063	I240F	probably damaging	Het
Xpot	T	A	10: 121,600,860	I873F	possibly damaging	Het
Zfhx4	G	A	3: 5,399,207	S1475N	probably damaging	Het
Zfp712	A	G	13: 67,041,015	S483P	possibly damaging	Het
Zswim7	A	T	11: 62,267,547	H122Q	probably benign	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCACGGACCTGGAAACTTTG -3'
(R):5'- TTCTCCCCAGTGAGTTGAAGG -3'

Sequencing Primer
(F):5'- CTGGAAACTTTGGGCCACAG -3'
(R):5'- CCAGTGAGTTGAAGGCCACTTTG -3'

Posted On

2016-08-04