Incidental Mutation 'R5361:Dopey2'
ID422832
Institutional Source Beutler Lab
Gene Symbol Dopey2
Ensembl Gene ENSMUSG00000022946
Gene Namedopey family member 2
Synonyms0610038M01Rik, 2610510B01Rik
MMRRC Submission 042940-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5361 (G1)
Quality Score221
Status Not validated
Chromosome16
Chromosomal Location93711904-93810590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93770504 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 1273 (A1273E)
Ref Sequence ENSEMBL: ENSMUSP00000154771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156]
Predicted Effect probably damaging
Transcript: ENSMUST00000045004
AA Change: A1391E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: A1391E

DomainStartEndE-ValueType
Pfam:Dopey_N 11 308 3.9e-104 PFAM
low complexity region 651 666 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 747 759 N/A INTRINSIC
low complexity region 1186 1199 N/A INTRINSIC
low complexity region 1436 1451 N/A INTRINSIC
low complexity region 1893 1908 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000226215
AA Change: A601E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226535
Predicted Effect unknown
Transcript: ENSMUST00000226836
AA Change: A553E
Predicted Effect probably damaging
Transcript: ENSMUST00000227156
AA Change: A1273E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T A 9: 57,257,185 K635N probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahnak T A 19: 9,015,341 M4663K possibly damaging Het
C4b T A 17: 34,741,238 T280S probably benign Het
Ccdc166 A G 15: 75,981,020 V366A probably benign Het
Cdh23 A G 10: 60,657,265 probably null Het
Col7a1 A G 9: 108,963,224 T1281A unknown Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Dbndd1 T A 8: 123,506,745 D127V probably damaging Het
Ddx20 T A 3: 105,683,509 E197V probably damaging Het
Dnm3 A G 1: 162,010,902 S826P probably damaging Het
Dnmt3a T C 12: 3,895,643 V24A probably benign Het
Dsg1c T C 18: 20,283,646 V868A possibly damaging Het
Dtx4 A G 19: 12,485,262 probably null Het
Elovl4 A G 9: 83,790,101 L55P possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam45a A G 19: 60,825,886 M96V probably benign Het
Fbxo40 T A 16: 36,969,552 T399S possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm14399 T C 2: 175,131,578 E96G probably damaging Het
Gm14496 T G 2: 182,000,354 V606G probably benign Het
Gpr156 A G 16: 38,005,725 E768G probably damaging Het
Grm5 A T 7: 88,074,496 T665S probably damaging Het
Hsdl2 A G 4: 59,592,301 probably benign Het
Htt T C 5: 34,907,584 V3047A possibly damaging Het
Igkv3-2 A T 6: 70,699,027 T107S probably benign Het
Itih2 T A 2: 10,096,461 T899S probably benign Het
Lhcgr T A 17: 88,742,853 Y415F probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Med4 C A 14: 73,510,113 S18* probably null Het
Nefl T C 14: 68,084,639 V226A probably damaging Het
Nploc4 T A 11: 120,384,563 N516Y probably damaging Het
Olfr798 A T 10: 129,625,732 F110I probably damaging Het
Olfr99 A G 17: 37,279,610 V270A probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdha3 T G 18: 36,946,699 L165V possibly damaging Het
Pcdhb12 T A 18: 37,437,046 V415D probably damaging Het
Pcdhga10 T C 18: 37,747,450 I88T probably damaging Het
Pigyl T A 9: 22,157,996 M1K probably null Het
Prr27 T C 5: 87,843,344 S272P probably damaging Het
Prss3 C T 6: 41,373,846 D237N probably benign Het
Pstpip2 A G 18: 77,870,378 D150G probably damaging Het
Robo4 T A 9: 37,413,378 D909E probably benign Het
Serpinb3c A T 1: 107,276,931 Y28* probably null Het
Slc26a3 T C 12: 31,450,981 probably null Het
Slc6a1 A T 6: 114,302,532 I91F probably benign Het
Smcr8 T G 11: 60,778,292 Y89D probably damaging Het
Sspo T A 6: 48,466,313 M1898K probably benign Het
Tbl1xr1 T A 3: 22,192,069 I251K probably damaging Het
Thbs4 C T 13: 92,776,993 D140N probably benign Het
Tmbim6 G A 15: 99,405,752 A108T probably benign Het
Trim10 T G 17: 36,875,436 L301R probably benign Het
Trpm7 A T 2: 126,829,241 I607N possibly damaging Het
Vmn2r9 T A 5: 108,848,063 I240F probably damaging Het
Xpot T A 10: 121,600,860 I873F possibly damaging Het
Zfhx4 G A 3: 5,399,207 S1475N probably damaging Het
Zfp712 A G 13: 67,041,015 S483P possibly damaging Het
Zswim7 A T 11: 62,267,547 H122Q probably benign Het
Other mutations in Dopey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dopey2 APN 16 93800026 unclassified probably benign
IGL00492:Dopey2 APN 16 93780782 missense probably benign 0.00
IGL00753:Dopey2 APN 16 93769624 missense probably benign
IGL00832:Dopey2 APN 16 93763401 missense probably benign 0.01
IGL00939:Dopey2 APN 16 93774083 missense possibly damaging 0.83
IGL01019:Dopey2 APN 16 93810229 missense probably benign 0.32
IGL01288:Dopey2 APN 16 93739293 missense possibly damaging 0.78
IGL01505:Dopey2 APN 16 93757116 missense possibly damaging 0.87
IGL01535:Dopey2 APN 16 93769958 nonsense probably null
IGL01696:Dopey2 APN 16 93770240 missense probably benign 0.00
IGL02077:Dopey2 APN 16 93780760 missense probably damaging 0.96
IGL02163:Dopey2 APN 16 93762427 missense possibly damaging 0.48
IGL02234:Dopey2 APN 16 93752151 missense probably benign
IGL02302:Dopey2 APN 16 93810117 missense probably benign 0.08
IGL02485:Dopey2 APN 16 93770822 missense probably damaging 1.00
IGL02563:Dopey2 APN 16 93777405 missense probably damaging 0.99
IGL02733:Dopey2 APN 16 93739191 missense possibly damaging 0.80
IGL02792:Dopey2 APN 16 93801572 missense possibly damaging 0.75
IGL02941:Dopey2 APN 16 93755473 missense probably benign 0.09
IGL03143:Dopey2 APN 16 93759655 missense probably benign
PIT4519001:Dopey2 UTSW 16 93762054 missense probably benign
R0320:Dopey2 UTSW 16 93810147 missense probably benign 0.02
R0499:Dopey2 UTSW 16 93770437 missense probably benign 0.00
R0501:Dopey2 UTSW 16 93752862 missense probably benign 0.00
R0534:Dopey2 UTSW 16 93762505 missense probably benign 0.04
R0583:Dopey2 UTSW 16 93755486 missense probably benign 0.30
R0626:Dopey2 UTSW 16 93763956 missense probably damaging 1.00
R0724:Dopey2 UTSW 16 93762325 missense probably benign 0.01
R0907:Dopey2 UTSW 16 93801593 missense probably damaging 1.00
R1263:Dopey2 UTSW 16 93777386 missense probably benign
R1378:Dopey2 UTSW 16 93770392 missense probably benign
R1572:Dopey2 UTSW 16 93770153 missense probably damaging 1.00
R1604:Dopey2 UTSW 16 93762570 missense probably benign
R1642:Dopey2 UTSW 16 93762315 missense probably benign 0.00
R1668:Dopey2 UTSW 16 93765516 missense probably damaging 1.00
R1669:Dopey2 UTSW 16 93769660 missense probably damaging 1.00
R1702:Dopey2 UTSW 16 93747621 missense possibly damaging 0.47
R1711:Dopey2 UTSW 16 93799926 missense probably damaging 1.00
R1917:Dopey2 UTSW 16 93716262 missense probably damaging 1.00
R1968:Dopey2 UTSW 16 93782419 missense probably damaging 1.00
R1988:Dopey2 UTSW 16 93766173 missense probably damaging 1.00
R2029:Dopey2 UTSW 16 93769435 missense probably benign 0.36
R2139:Dopey2 UTSW 16 93771007 missense possibly damaging 0.78
R2355:Dopey2 UTSW 16 93770677 missense probably damaging 1.00
R3609:Dopey2 UTSW 16 93739332 missense probably damaging 1.00
R3792:Dopey2 UTSW 16 93771846 missense possibly damaging 0.54
R4364:Dopey2 UTSW 16 93770924 missense probably benign 0.00
R4380:Dopey2 UTSW 16 93716232 missense possibly damaging 0.53
R4455:Dopey2 UTSW 16 93766215 missense probably damaging 1.00
R4779:Dopey2 UTSW 16 93757081 missense probably damaging 1.00
R4820:Dopey2 UTSW 16 93793090 missense probably benign 0.00
R4834:Dopey2 UTSW 16 93740004 start codon destroyed probably null 0.70
R4866:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R4882:Dopey2 UTSW 16 93752914 missense possibly damaging 0.95
R4900:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R5153:Dopey2 UTSW 16 93774003 missense probably damaging 0.98
R5176:Dopey2 UTSW 16 93740043 missense probably damaging 1.00
R5206:Dopey2 UTSW 16 93801584 missense probably damaging 1.00
R5320:Dopey2 UTSW 16 93739986 missense probably damaging 1.00
R5380:Dopey2 UTSW 16 93763410 missense probably damaging 0.96
R5476:Dopey2 UTSW 16 93773913 splice site probably null
R5502:Dopey2 UTSW 16 93793226 missense probably benign 0.00
R5543:Dopey2 UTSW 16 93798920 missense probably damaging 0.98
R5557:Dopey2 UTSW 16 93763931 missense probably damaging 0.96
R5901:Dopey2 UTSW 16 93769751 missense possibly damaging 0.88
R5907:Dopey2 UTSW 16 93801581 missense probably damaging 1.00
R6174:Dopey2 UTSW 16 93766222 missense probably damaging 1.00
R6256:Dopey2 UTSW 16 93807214 missense possibly damaging 0.94
R6383:Dopey2 UTSW 16 93782248 missense possibly damaging 0.76
R6525:Dopey2 UTSW 16 93809416 missense probably damaging 1.00
R6554:Dopey2 UTSW 16 93760458 missense probably benign 0.22
R6823:Dopey2 UTSW 16 93755485 missense possibly damaging 0.75
R7036:Dopey2 UTSW 16 93777490 missense probably benign 0.01
R7058:Dopey2 UTSW 16 93776990 missense probably benign 0.00
R7061:Dopey2 UTSW 16 93762063 missense probably benign 0.00
R7209:Dopey2 UTSW 16 93769845 missense probably benign
R7214:Dopey2 UTSW 16 93810135 missense possibly damaging 0.69
R7232:Dopey2 UTSW 16 93760485 critical splice donor site probably null
R7255:Dopey2 UTSW 16 93770146 missense probably damaging 1.00
R7335:Dopey2 UTSW 16 93747508 missense probably benign 0.04
R7535:Dopey2 UTSW 16 93806361 missense probably damaging 1.00
R7763:Dopey2 UTSW 16 93755514 missense probably benign 0.00
R7814:Dopey2 UTSW 16 93799971 missense probably damaging 1.00
R7839:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7862:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7894:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R7922:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7945:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7977:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R8033:Dopey2 UTSW 16 93769483 missense probably benign
R8061:Dopey2 UTSW 16 93749996 missense probably damaging 1.00
R8067:Dopey2 UTSW 16 93765448 nonsense probably null
Z1088:Dopey2 UTSW 16 93763326 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93769581 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93803546 missense probably damaging 1.00
Z1176:Dopey2 UTSW 16 93807868 missense possibly damaging 0.82
Z1177:Dopey2 UTSW 16 93763895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCGGCCAGAGCTTTTATGG -3'
(R):5'- TGGAAGTTGAGAGCCCTCTG -3'

Sequencing Primer
(F):5'- CCAGAGCTTTTATGGCAAGC -3'
(R):5'- TCTGCCACTCTCGGGATAG -3'
Posted On2016-08-04