Incidental Mutation 'R5361:Dtx4'
ID 422847
Institutional Source Beutler Lab
Gene Symbol Dtx4
Ensembl Gene ENSMUSG00000039982
Gene Name deltex 4, E3 ubiquitin ligase
Synonyms RNF155
MMRRC Submission 042940-MU
Accession Numbers

Genbank: NM_001047855

Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R5361 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 12466341-12501996 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 12485262 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521]
AlphaFold Q6PDK8
Predicted Effect probably null
Transcript: ENSMUST00000045521
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T A 9: 57,257,185 K635N probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahnak T A 19: 9,015,341 M4663K possibly damaging Het
C4b T A 17: 34,741,238 T280S probably benign Het
Ccdc166 A G 15: 75,981,020 V366A probably benign Het
Cdh23 A G 10: 60,657,265 probably null Het
Col7a1 A G 9: 108,963,224 T1281A unknown Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Dbndd1 T A 8: 123,506,745 D127V probably damaging Het
Ddx20 T A 3: 105,683,509 E197V probably damaging Het
Dnm3 A G 1: 162,010,902 S826P probably damaging Het
Dnmt3a T C 12: 3,895,643 V24A probably benign Het
Dopey2 C A 16: 93,770,504 A1273E probably damaging Het
Dsg1c T C 18: 20,283,646 V868A possibly damaging Het
Elovl4 A G 9: 83,790,101 L55P possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam45a A G 19: 60,825,886 M96V probably benign Het
Fbxo40 T A 16: 36,969,552 T399S possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm14399 T C 2: 175,131,578 E96G probably damaging Het
Gm14496 T G 2: 182,000,354 V606G probably benign Het
Gpr156 A G 16: 38,005,725 E768G probably damaging Het
Grm5 A T 7: 88,074,496 T665S probably damaging Het
Hsdl2 A G 4: 59,592,301 probably benign Het
Htt T C 5: 34,907,584 V3047A possibly damaging Het
Igkv3-2 A T 6: 70,699,027 T107S probably benign Het
Itih2 T A 2: 10,096,461 T899S probably benign Het
Lhcgr T A 17: 88,742,853 Y415F probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Med4 C A 14: 73,510,113 S18* probably null Het
Nefl T C 14: 68,084,639 V226A probably damaging Het
Nploc4 T A 11: 120,384,563 N516Y probably damaging Het
Olfr798 A T 10: 129,625,732 F110I probably damaging Het
Olfr99 A G 17: 37,279,610 V270A probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdha3 T G 18: 36,946,699 L165V possibly damaging Het
Pcdhb12 T A 18: 37,437,046 V415D probably damaging Het
Pcdhga10 T C 18: 37,747,450 I88T probably damaging Het
Pigyl T A 9: 22,157,996 M1K probably null Het
Prr27 T C 5: 87,843,344 S272P probably damaging Het
Prss3 C T 6: 41,373,846 D237N probably benign Het
Pstpip2 A G 18: 77,870,378 D150G probably damaging Het
Robo4 T A 9: 37,413,378 D909E probably benign Het
Serpinb3c A T 1: 107,276,931 Y28* probably null Het
Slc26a3 T C 12: 31,450,981 probably null Het
Slc6a1 A T 6: 114,302,532 I91F probably benign Het
Smcr8 T G 11: 60,778,292 Y89D probably damaging Het
Sspo T A 6: 48,466,313 M1898K probably benign Het
Tbl1xr1 T A 3: 22,192,069 I251K probably damaging Het
Thbs4 C T 13: 92,776,993 D140N probably benign Het
Tmbim6 G A 15: 99,405,752 A108T probably benign Het
Trim10 T G 17: 36,875,436 L301R probably benign Het
Trpm7 A T 2: 126,829,241 I607N possibly damaging Het
Vmn2r9 T A 5: 108,848,063 I240F probably damaging Het
Xpot T A 10: 121,600,860 I873F possibly damaging Het
Zfhx4 G A 3: 5,399,207 S1475N probably damaging Het
Zfp712 A G 13: 67,041,015 S483P possibly damaging Het
Zswim7 A T 11: 62,267,547 H122Q probably benign Het
Other mutations in Dtx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Dtx4 APN 19 12478215 missense possibly damaging 0.88
IGL02173:Dtx4 APN 19 12473257 nonsense probably null
IGL03127:Dtx4 APN 19 12486500 splice site probably benign
G5030:Dtx4 UTSW 19 12469579 missense probably benign 0.07
R0143:Dtx4 UTSW 19 12486482 missense probably damaging 0.98
R0932:Dtx4 UTSW 19 12492151 missense probably benign
R1066:Dtx4 UTSW 19 12501009 missense probably damaging 0.98
R2155:Dtx4 UTSW 19 12485282 nonsense probably null
R2182:Dtx4 UTSW 19 12483107 missense probably null 0.75
R2362:Dtx4 UTSW 19 12492535 missense probably damaging 1.00
R3880:Dtx4 UTSW 19 12486456 missense probably benign 0.01
R4108:Dtx4 UTSW 19 12501123 missense probably damaging 0.96
R4361:Dtx4 UTSW 19 12485296 missense probably benign 0.04
R4943:Dtx4 UTSW 19 12501060 missense probably damaging 1.00
R5440:Dtx4 UTSW 19 12492317 missense probably damaging 1.00
R5613:Dtx4 UTSW 19 12485403 missense probably damaging 0.97
R5614:Dtx4 UTSW 19 12482183 missense probably damaging 1.00
R5703:Dtx4 UTSW 19 12482210 missense possibly damaging 0.84
R5994:Dtx4 UTSW 19 12501153 missense probably damaging 1.00
R6695:Dtx4 UTSW 19 12473235 nonsense probably null
R7107:Dtx4 UTSW 19 12473260 nonsense probably null
R7208:Dtx4 UTSW 19 12482073 critical splice donor site probably null
R7231:Dtx4 UTSW 19 12469658 nonsense probably null
R7521:Dtx4 UTSW 19 12492497 missense probably benign 0.30
R7609:Dtx4 UTSW 19 12492281 missense probably damaging 1.00
R7721:Dtx4 UTSW 19 12482136 missense probably benign 0.09
R7775:Dtx4 UTSW 19 12492010 missense probably benign 0.02
R8685:Dtx4 UTSW 19 12469631 missense probably benign 0.36
Z1176:Dtx4 UTSW 19 12491909 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTAGTTCTTTCTGACCCAGAC -3'
(R):5'- TTGGGAGCGCATTCTTCAGC -3'

Sequencing Primer
(F):5'- AGACCCAACTCTCTTTGGTGGAC -3'
(R):5'- GCGCATTCTTCAGCCCGTTC -3'
Posted On 2016-08-04