Incidental Mutation 'R5362:Gpc1'
ID422851
Institutional Source Beutler Lab
Gene Symbol Gpc1
Ensembl Gene ENSMUSG00000034220
Gene Nameglypican 1
Synonyms
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92831645-92860779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92854893 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 121 (T121S)
Ref Sequence ENSEMBL: ENSMUSP00000047199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045970]
Predicted Effect probably benign
Transcript: ENSMUST00000045970
AA Change: T121S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047199
Gene: ENSMUSG00000034220
AA Change: T121S

DomainStartEndE-ValueType
Pfam:Glypican 11 553 6.2e-228 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190677
Predicted Effect probably benign
Transcript: ENSMUST00000212504
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a reduced brain size with mild cerebellar patterning defects, but are otherwise viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Gpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Gpc1 APN 1 92857014 missense probably damaging 1.00
IGL01697:Gpc1 APN 1 92858410 missense possibly damaging 0.93
IGL02282:Gpc1 APN 1 92857967 missense probably damaging 1.00
IGL02930:Gpc1 APN 1 92857299 nonsense probably null
IGL03160:Gpc1 APN 1 92857857 missense probably damaging 1.00
PIT4514001:Gpc1 UTSW 1 92857557 missense probably benign 0.05
R0115:Gpc1 UTSW 1 92857499 missense probably damaging 1.00
R0383:Gpc1 UTSW 1 92854983 missense probably damaging 1.00
R0399:Gpc1 UTSW 1 92857309 missense possibly damaging 0.72
R0938:Gpc1 UTSW 1 92857309 missense possibly damaging 0.72
R0941:Gpc1 UTSW 1 92857309 missense possibly damaging 0.72
R0942:Gpc1 UTSW 1 92857309 missense possibly damaging 0.72
R2483:Gpc1 UTSW 1 92855938 missense probably benign 0.35
R3749:Gpc1 UTSW 1 92857582 nonsense probably null
R5033:Gpc1 UTSW 1 92857029 missense probably damaging 0.97
R5154:Gpc1 UTSW 1 92857029 missense probably damaging 0.97
R5626:Gpc1 UTSW 1 92857119 critical splice donor site probably null
R5693:Gpc1 UTSW 1 92857899 missense probably damaging 1.00
R7268:Gpc1 UTSW 1 92858371 missense possibly damaging 0.76
R7790:Gpc1 UTSW 1 92853449 missense probably benign
R7875:Gpc1 UTSW 1 92855248 critical splice donor site probably null
X0020:Gpc1 UTSW 1 92854981 missense probably benign 0.00
Z1177:Gpc1 UTSW 1 92857486 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TATGACCCTAGAGAGGCCACTC -3'
(R):5'- TCCAGGTAGTCATCAGGCAG -3'

Sequencing Primer
(F):5'- GAAGCCTCTGCAATATGGTGTCC -3'
(R):5'- TAGTCATCAGGCAGCAGCTG -3'
Posted On2016-08-04