Incidental Mutation 'R5362:Sertad4'
ID422852
Institutional Source Beutler Lab
Gene Symbol Sertad4
Ensembl Gene ENSMUSG00000016262
Gene NameSERTA domain containing 4
SynonymsC130018M11Rik
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location192844488-192855756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 192847106 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 134 (N134S)
Ref Sequence ENSEMBL: ENSMUSP00000116176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016406] [ENSMUST00000155503] [ENSMUST00000155579]
Predicted Effect probably damaging
Transcript: ENSMUST00000016406
AA Change: N134S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016406
Gene: ENSMUSG00000016262
AA Change: N134S

DomainStartEndE-ValueType
low complexity region 31 47 N/A INTRINSIC
Pfam:SERTA 108 144 1.1e-18 PFAM
low complexity region 212 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155503
AA Change: N134S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142132
Gene: ENSMUSG00000016262
AA Change: N134S

DomainStartEndE-ValueType
low complexity region 31 47 N/A INTRINSIC
Pfam:SERTA 108 144 1.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155579
AA Change: N134S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116176
Gene: ENSMUSG00000016262
AA Change: N134S

DomainStartEndE-ValueType
low complexity region 31 47 N/A INTRINSIC
Pfam:SERTA 108 144 3.5e-20 PFAM
low complexity region 212 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190576
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Izumo3 A T 4: 92,146,800 I60K possibly damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Sertad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01974:Sertad4 APN 1 192846966 nonsense probably null
R1531:Sertad4 UTSW 1 192850950 critical splice donor site probably null
R1783:Sertad4 UTSW 1 192847032 missense probably benign 0.00
R4106:Sertad4 UTSW 1 192846742 small deletion probably benign
R5165:Sertad4 UTSW 1 192846822 missense possibly damaging 0.85
R6243:Sertad4 UTSW 1 192850949 splice site probably null
R7438:Sertad4 UTSW 1 192846710 missense possibly damaging 0.71
R7699:Sertad4 UTSW 1 192846867 missense possibly damaging 0.95
R7980:Sertad4 UTSW 1 192846881 missense probably benign
R8017:Sertad4 UTSW 1 192846521 missense probably benign 0.34
R8019:Sertad4 UTSW 1 192846521 missense probably benign 0.34
RF001:Sertad4 UTSW 1 192847178 missense probably damaging 1.00
Z1088:Sertad4 UTSW 1 192847031 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGCAAGTGTGGATCTTTTCCC -3'
(R):5'- CTCAGGTCCACACTAGTAAGTTAGG -3'

Sequencing Primer
(F):5'- AAGTGTGGATCTTTTCCCACTCC -3'
(R):5'- AATGGGGCCAGCCTCTAAACG -3'
Posted On2016-08-04