Incidental Mutation 'R5362:Izumo3'
ID422861
Institutional Source Beutler Lab
Gene Symbol Izumo3
Ensembl Gene ENSMUSG00000028533
Gene NameIZUMO family member 3
Synonyms1700011H22Rik
MMRRC Submission 043264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5362 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location92144329-92147234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92146800 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 60 (I60K)
Ref Sequence ENSEMBL: ENSMUSP00000102725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107108] [ENSMUST00000143542]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107108
AA Change: I60K

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102725
Gene: ENSMUSG00000028533
AA Change: I60K

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:IZUMO 22 165 6.7e-44 PFAM
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143542
SMART Domains Protein: ENSMUSP00000121187
Gene: ENSMUSG00000028533

DomainStartEndE-ValueType
Pfam:IZUMO 3 95 4.2e-27 PFAM
transmembrane domain 109 131 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik A T 6: 133,294,482 D163V probably benign Het
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd17 G A 5: 90,265,545 A1170V probably damaging Het
Ano1 A C 7: 144,648,600 probably benign Het
Atl2 T C 17: 79,861,461 N37D probably damaging Het
C2cd5 T C 6: 143,083,243 Y90C probably damaging Het
Carm1 A G 9: 21,587,359 N499S probably benign Het
Ccdc47 G A 11: 106,208,213 probably null Het
Cd300lf G T 11: 115,117,114 L251M probably damaging Het
Cfap74 A G 4: 155,438,166 S670G probably damaging Het
Clec4a1 A G 6: 122,932,237 D188G probably damaging Het
Col4a1 T C 8: 11,245,760 probably benign Het
Csn2 T A 5: 87,694,649 H165L probably benign Het
Dlx3 T C 11: 95,120,500 V60A possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam221a A G 6: 49,376,115 H21R probably damaging Het
Foxj3 T A 4: 119,620,143 H349Q unknown Het
Gm37240 G A 3: 84,515,693 T123I probably damaging Het
Gpc1 A T 1: 92,854,893 T121S probably benign Het
Ikbkap A C 4: 56,778,969 I616S probably damaging Het
Itga2b A G 11: 102,461,135 V512A probably damaging Het
Itgae A G 11: 73,111,849 Y144C probably damaging Het
Kif9 G A 9: 110,489,944 V159M probably damaging Het
Lrp1b T C 2: 41,375,902 D229G probably damaging Het
Nkpd1 G A 7: 19,523,268 G324D probably damaging Het
Nrp2 T A 1: 62,769,062 Y617N probably benign Het
Ocm T C 5: 144,023,856 D91G probably damaging Het
Olfr600 A G 7: 103,346,247 V227A probably damaging Het
Olfr667 A G 7: 104,916,627 I223T probably damaging Het
Olfr724 A G 14: 49,960,529 L181P possibly damaging Het
Olfr814 T C 10: 129,874,553 E68G probably damaging Het
Pex5l G A 3: 32,992,916 A295V probably damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Pou2f2 G A 7: 25,092,895 P512S probably benign Het
Prpf8 G A 11: 75,506,410 R2023Q possibly damaging Het
Ptprd A T 4: 76,128,813 S399R probably damaging Het
Qrich2 T C 11: 116,447,150 Y1889C probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ranbp6 G T 19: 29,811,728 T408K probably benign Het
Scn7a G A 2: 66,699,998 R668C probably damaging Het
Sertad4 T C 1: 192,847,106 N134S probably damaging Het
Spg11 G T 2: 122,061,000 N1963K probably damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Top2a T C 11: 99,018,912 N120S probably damaging Het
Trappc9 C T 15: 73,058,217 E97K possibly damaging Het
Vmn1r91 A T 7: 20,101,461 T102S probably benign Het
Vmn2r99 G T 17: 19,379,339 M428I probably benign Het
Zfp62 A T 11: 49,216,612 H510L probably damaging Het
Other mutations in Izumo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Izumo3 APN 4 92146980 intron probably benign
IGL01323:Izumo3 APN 4 92146390 splice site probably benign
IGL01586:Izumo3 APN 4 92146295 critical splice donor site probably null
IGL02794:Izumo3 APN 4 92146963 missense probably benign
IGL03146:Izumo3 APN 4 92145039 missense probably damaging 0.97
IGL03180:Izumo3 APN 4 92146287 splice site probably benign
R0053:Izumo3 UTSW 4 92145030 missense probably damaging 0.99
R0137:Izumo3 UTSW 4 92147200 splice site probably benign
R1222:Izumo3 UTSW 4 92145047 missense probably damaging 1.00
R1558:Izumo3 UTSW 4 92146903 missense probably damaging 1.00
R1605:Izumo3 UTSW 4 92144740 missense probably damaging 0.99
R4413:Izumo3 UTSW 4 92146899 missense probably damaging 1.00
R4834:Izumo3 UTSW 4 92146971 missense possibly damaging 0.95
R7348:Izumo3 UTSW 4 92147218 missense possibly damaging 0.71
R7783:Izumo3 UTSW 4 92145023 missense probably damaging 0.98
R8104:Izumo3 UTSW 4 92146908 nonsense probably null
R8343:Izumo3 UTSW 4 92146344 missense probably damaging 0.99
Z1088:Izumo3 UTSW 4 92146933 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGTGTGGGGTAGGCAATAATC -3'
(R):5'- GTGAACCAGTTGCCAAGACAAC -3'

Sequencing Primer
(F):5'- TGTGGGGTAGGCAATAATCATATC -3'
(R):5'- GTTGCCAAGACAACCTGTG -3'
Posted On2016-08-04